SNP and SCAR Markers for Specific Discrimination of Antler-Shaped Ganoderma lucidum
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains and Culture Conditions
2.2. DNA Extraction and Amplification
2.3. Cloning, Sequencing and Sequence Analysis
2.4. SNP Detection and Validation
2.5. SCAR Primer Design and Validation
2.6. Cultivation of G. lucidum Fruit Body
3. Results
3.1. SNP Analysis of Partial Mitochondrial SSU rDNA Gene
3.2. Development of SCAR Marker for Antler-Shaped G. lucidum
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Curtis, W. Flora Londinensis: Plates and Descriptions of Such Plants as Grow Wild in the Environs of London; Printed by the Author: London, UK, 1781; p. 530. [Google Scholar] [CrossRef]
- Fries, E.M. Systema Mycologicum: Sistens Fungorum Ordines, Genera et Species, huc usque cognitas, quas ad Normam Methodi Naturalis Determinavit; Ex Officina Berlingiana: Lundae, Sweden, 1821–1832; Volume 1. [Google Scholar] [CrossRef]
- Wang, X.C.; Xi, R.J.; Li, Y.; Wang, D.M.; Yao, Y.J. The species identity of the widely cultivated Ganoderma, ‘G. lucidum’ (Ling-zhi), in China. PLoS ONE 2012, 7, e40857. [Google Scholar] [CrossRef] [PubMed]
- Kao, C.H.J.; Jesuthasan, A.C.; Bishop, K.S.; Glucina, M.P.; Ferguson, L.R. Anti-cancer activities of Ganoderma lucidum: Active ingredients and pathways. Funct. Foods Health Dis. 2013, 3, 48–65. [Google Scholar] [CrossRef]
- Komada, Y.; Shimizu, M.; Sonoda, Y.; Sato, Y. Ganoderic acid and its derivatives as cholesterol synthesis inhibitors. Chem. Pharm. Bull. 1989, 37, 531–533. [Google Scholar] [CrossRef]
- Wang, Y.Y.; Kho, K.H.; Chen, S.T.; Lin, C.C.; Wong, C.H.; Lin, C.H. Studies on the immuno-modulating and antitumor activities of Ganoderma lucidum (Reishi) polysaccharides: Functional and proteomic analyses of a fucose-containing glycoprotein fraction responsible for the activities. Bioorg. Med. Chem. 2002, 10, 1057–1062. [Google Scholar] [CrossRef]
- Shi, L.; Ren, A.; Mu, D.; Zhao, M. Current progress in the study on biosynthesis and regulation of ganoderic acids. Appl. Microbiol. Biotechnol. 2010, 88, 1243–1251. [Google Scholar] [CrossRef] [PubMed]
- Nonaka, Y.; Shibata, H.; Nakai, M.; Kurihara, H.; Ishibashi, H.; Kiso, Y.; Tanaka, T.; Yamaguchi, H.; Abe, S. Anti-tumor activities of the antlered form of Ganoderma lucidum in allogeneic and syngeneic tumor-bearing mice. Biosci. Biotechnol. Biochem. 2006, 70, 2028–2034. [Google Scholar] [CrossRef] [PubMed]
- Upton, R. Reishi Mushroom Ganoderma Lucidum Standards of Analysis, Quality Control, and Therapeutics; American Herbal Pharmacopoeia: Santa Cruz, CA, USA, 2000; pp. 13–20. [Google Scholar]
- Katagata, Y.; Sasaki, F. Antiproliferative activity of extracts prepared from three species of Reishi on cultured human normal and tumor cell lines. Mol. Med. Rep. 2010, 3, 179–184. [Google Scholar] [CrossRef]
- Min, B.S.; Nakamura, N.; Miyashiro, H.; Bae, K.W.; Hattori, M. Triterpenes from the spore of Ganoderma lucidum and their inhibitory activity against HIV-1 protease. Chem. Pharm. Bull. 1998, 46, 1607–1612. [Google Scholar] [CrossRef]
- Kohguchi, M.; Kunikata, T.; Watanabe, H.; Kudo, N.; Shibuya, T.; Ishihara, T.; Iwaki, K.; Ikeda, M.; Fukuda, S.; Kurimoto, M. Immuno-potentiating effects of the antler-shaped fruiting body of Ganoderma lucidum (Rokkaku-Reishi). Biosci. Biotechnol. Biochem. 2004, 68, 881–887. [Google Scholar] [CrossRef]
- Watanabe, K.; Shuto, T.; Sato, M.; Onuki, K.; Mizunoe, S.; Suzuki, S.; Sato, T.; Koga, T.; Suico, M.A.; Kai, H.; Ikeda, T. Lucidenic acids-rich extract from antlered form of Ganoderma lucidum enhances TNFα induction in THP-1 monocytic cells possibly via its modulation of MAP kinases p38 and JNK. Biochem. Biophys. Res. Commun. 2011, 408, 18–24. [Google Scholar] [CrossRef]
- Zhou, L.W.; Nakasone, K.K.; Burdsall, H.H.; Ginns, J.; Vlasák, J.; Miettinen, O.; Spirin, V.; Niemela, T.; Yuan, H.S.; He, S.H. Polypore diversity in North America with an annotated checklist. Mycol. Prog. 2016, 15, 771–790. [Google Scholar] [CrossRef]
- Moncalvo, J.M.; Wang, H.F.; Hseu, R.S. Gene phylogeny of the Ganoderma lucidum complex based on ribosomal DNA sequences: Comparison with traditional taxonomic characters. Mycol. Res. 1995, 99, 1489–1499. [Google Scholar] [CrossRef]
- Gottlieb, A.M.; Ferrer, E.; Wright, J.E. rDNA analyses as an aid to the taxonomy of species of Ganoderma. Mycol. Res. 2000, 104, 1033–1045. [Google Scholar] [CrossRef]
- Smith, B.J.; Sivasithamparam, K. Internal transcribed spacer ribosomal DNA sequence of five species of Ganoderma from Australia. Mycol. Res. 2000, 104, 943–951. [Google Scholar] [CrossRef]
- Hong, S.G.; Jung, H.S. Phylogenetic analysis of Ganoderma based on nearly complete mitochondrial small-subunit ribosomal DNA sequences. Mycologia 2004, 96, 742–755. [Google Scholar] [CrossRef]
- Park, Y.J.; Kwon, O.C.; Son, E.S.; Yoon, D.E.; Han, W.; Nam, J.Y.; Yoo, Y.B.; Lee, C.S. Genetic diversity analysis of Ganoderma species and development of a specific marker for identification of medicinal mushroom Ganoderma lucidum. Afr. J. Microbiol. Res. 2012, 6, 5417–5425. [Google Scholar] [CrossRef]
- Sun, S.J.; Gao, W.; Lin, S.Q.; Zhu, J.; Xie, B.G.; Lin, Z.B. Analysis of genetic diversity in Ganoderma population with a novel molecular marker SRAP. Appl. Microbiol. Biotechnol. 2006, 72, 537–543. [Google Scholar] [CrossRef]
- Zheng, L.; Jia, D.; Fei, X.; Luo, X.; Yang, Z. An assessment of the genetic diversity within Ganoderma strains with AFLP and ITS PCR-RFLP. Microbiol. Res. 2009, 164, 312–321. [Google Scholar] [CrossRef] [PubMed]
- Rolim, L.D.N.; Cavalcante, M.A.D.Q.; Urben, A.F.; Buso, G.S.C. Use of RAPD molecular markers on differentiation of Brazilian and Chinese Ganoderma lucidum strains. Braz. Arch. Biol. Technol. 2011, 54, 273–281. [Google Scholar] [CrossRef]
- Jones, N.; Ougham, H.; Thomas, H.; Pasakinskiene, I. Markers and mapping revisited: Finding your gene. New Phytol. 2009, 183, 935–966. [Google Scholar] [CrossRef]
- Yang, C.H.; Cheng, Y.H.; Chuang, L.Y. A natural PCR-RFLP primer design for SNP genotyping using a genetic algorithm. In Proceedings of the International MultiConference of Engineers and Computer Scientists, IMECS, Hong Kong, China, 17–19 March 2010; Available online: https://www.researchgate.net/publication/44260566_A_natural_PCR-RFLP_primer_design_for_SNP_genotyping_using_a_genetic_algorithm (accessed on 1 March 2017).
- Ota, M.; Fukushima, H.; Kulski, J.K.; Inoko, H. Single nucleotide polymorphism detection by polymerase chain reaction-restriction fragment length polymorphism. Nat. Protoc. 2007, 2, 2857–2864. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xu, J.; Sha, T.A.O.; Li, Y.C.; Zhao, Z.W.; Yang, Z.L. Recombination and genetic differentiation among natural populations of the ectomycorrhizal mushroom Tricholoma matsutake from southwestern China. Mol. Ecol. 2008, 17, 1238–1247. [Google Scholar] [CrossRef] [PubMed]
- Antoni, R. Applications of single nucleotide polymorphisms in crop genetics. Curr. Opin. Plant Biol. 2002, 5, 94–100. [Google Scholar] [CrossRef]
- Vignal, A.; Milan, D.; SanCristobal, M.; Eggen, A. A review on SNP and other types of molecular markers and their use in animal genetics. Genet. Sel. Evol. 2002, 34, 275–305. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Guo, H.; Yang, Z.L. Single nucleotide polymorphisms in the ectomycorrhizal mushroom Tricholoma matsutake. Microbiology 2007, 153, 2002–2012. [Google Scholar] [CrossRef] [PubMed]
- Ferri, L.; Perrin, E.; Campana, S.; Tabacchioni, S.; Taccetti, G.; Cocchi, P.; Ravenni, N.; Dalmastri, C.; Chiarini, L.; Bevivino, A.; et al. Application of multiplex single nucleotide primer extension (mSNuPE) to the identification of bacteria: The Burkholderia cepacia complex case. J. Microbiol. Methods 2010, 80, 251–256. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.J.; Mei, Z.Q.; Tania, M.; Yang, L.Q.; Cheng, J.L.; Khan, M.A. Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning. Genet. Mol. Res. 2015, 14, 5667–5676. [Google Scholar] [CrossRef]
- Wachtel-Galor, S.; Benzie, I.F. Ganoderma lucidum (Lingzhi or Reishi): A medicinal mushroom. In Herbal medicine: Biomolecular and Clinical Aspects, 2nd ed.; Wachtel-Galor, S., Yuen, J., Buswell, J.A., Benzie, I.F.F., Eds.; CRC Press/Taylor & Francis: Boca Raton, FL, USA, 2011; ISBN 9781439807132. Available online: https://www.ncbi.nlm.nih.gov/books/NBK92757/ (accessed on 1 March 2017).
- Cao, H.; But, P.P.; Shaw, P.C. Methodological studies on genomic DNA extraction and purification from plant drug materials. J. Chin. Pharm. Sci. 1998, 7, 130–137. [Google Scholar]
- Hong, S.G.; Jeong, W.; Jung, H.S. Amplification of mitochondrial small subunit ribosomal DNA of polypores and its potential for phylogenetic analysis. Mycologia 2002, 94, 823–833. [Google Scholar] [CrossRef]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 4th ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989; Volume 1, pp. 157–174. ISBN 9781936113422. [Google Scholar]
- Boh, B.; Berovic, M.; Zhang, J.; Zhi-Bin, L. Ganoderma lucidum and its pharmaceutically active compounds. Biotechnol. Annu. Rev. 2007, 13, 265–301. [Google Scholar] [CrossRef]
- Sanodiya, B.S.; Thakur, G.S.; Baghel, R.K.; Prasad, G.B.; Bisen, P.S. Ganoderma lucidum: A potent pharmacological macrofungus. Curr. Pharm. Biotechnol. 2009, 10, 717–742. [Google Scholar] [CrossRef] [PubMed]
- Sudheer, S.; Taha, Z.; Manickam, S.; Ali, A.; Cheng, P.G. Development of antler-type fruiting bodies of Ganoderma lucidum and determination of its biochemical properties. Fungal Biol. 2018, 122, 293–301. [Google Scholar] [CrossRef] [PubMed]
- Brown, W.M.; George, M., Jr.; Wilson, A.C. Rapid evolution of animal mitochondrial DNA. Proc. Natl. Acad. Sci. USA 1979, 76, 1967–1971. [Google Scholar] [CrossRef]
- Peever, T.L.; Canihos, Y.; Olsen, L.; Ibanez, A.; Liu, Y.C.; Timmer, L.W. Population genetic structure and host specificity of Alternaria spp. causing brown spot of Minneola tangelo and rough lemon in Florida. Phytopathology 1999, 89, 851–860. [Google Scholar] [CrossRef] [PubMed]
- Vakalounakis, D.J.; Fragkiadakis, G.A. Genetic diversity of Fusarium oxysporum isolates from cucumber: Differentiation by pathogenicity, vegetative compatibility, and RAPD fingerprinting. Phytopathology 1999, 89, 161–168. [Google Scholar] [CrossRef] [PubMed]
- Yoder, W.T.; Christianson, L.M. Species-specific primers resolve members of Fusarium section Fusarium: Taxonomic status of the edible “Quorn” fungus reevaluated. Fungal Genet. Biol. 1998, 23, 68–80. [Google Scholar] [CrossRef] [PubMed]
- Manulis, S.; Kogan, N.; Reuven, M.; Yephet, Y.B. Use of the RAPD technique for identification of Fusarium oxysporum f. sp. dianthi from carnation. Phytopathology 1994, 84, 98–101. [Google Scholar] [CrossRef]
- Goodwin, P.H.; Annis, S.L. Rapid identification of genetic variation and pathotype of Leptosphaeria maculans by random amplified polymorphic DNA assay. Appl. Environ. Microbiol. 1991, 57, 2482–2486. [Google Scholar] [PubMed]
- Kang, H.W.; Park, D.S.; Go, S.J.; Eun, M.Y. Fingerprinting of diverse genomes using PCR with universal rice primers generated from repetitive sequence of Korean weedy rice. Mol. Cells 2002, 13, 281–287. [Google Scholar]
- Aggarwal, R.; Singh, V.B.; Shukla, R.; Gurjar, M.S.; Gupta, S.; Sharma, T.R. URP-based DNA fingerprinting of Bipolaris sorokiniana isolates causing spot blotch of wheat. J. Phytopathol. 2010, 158, 210–216. [Google Scholar] [CrossRef]
- González, N.; Godoy-Lutz, G.; Steadman, J.R.; Higgins, R.; Eskridge, K.M. Assessing genetic diversity in the web blight pathogen Thanatephorus cucumeris (anamorph= Rhizoctonia solani) subgroups AG-1-IE and AG-1-IF with molecular markers. J. Gen. Plant Pathol. 2012, 78, 85–98. [Google Scholar] [CrossRef]
- Aggarwal, R.; Gupta, S.; Banerjee, S.; Singh, V.B. Development of a SCAR marker for detection of Bipolaris sorokiniana causing spot blotch of wheat. Can. J. Microbiol. 2011, 57, 934–942. [Google Scholar] [CrossRef] [PubMed]
- Jana, T.K.; Singh, N.K.; Koundal, K.R.; Sharma, T.R. Genetic differentiation of charcoal rot pathogen, Macrophomina phaseolina, into specific groups using URP-PCR. Can. J. Microbiol. 2005, 51, 159–164. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.W.; Park, D.S.; Park, Y.J.; You, C.H.; Lee, B.M.; Eun, M.Y.; Go, S.J. Genomic differentiation among oyster mushroom cultivars released in Korea by URP-PCR fingerprinting. Mycobiology 2001, 29, 85–89. [Google Scholar] [CrossRef]
No. | Species | Collection | Origin | Shape |
---|---|---|---|---|
1 | Ganoderma lucidum | 1 ASI-7013 | Korea | antler |
2 | Ganoderma lucidum | ASI-7135 | Korea | antler |
3 | Ganoderma lucidum | ASI-7146 | Korea | antler |
4 | Ganoderma lucidum | ASI-7074 | Korea | antler |
5 | Ganoderma lucidum | ASI-7094 | Korea | antler |
6 | Ganoderma lucidum | ASI-7004 | Korea | kidney |
7 | Ganoderma lucidum | ASI-7071 | Korea | kidney |
8 | Ganoderma lucidum | ASI-7091 | Korea | kidney |
9 | Ganoderma lucidum | ASI-7117 | Korea | kidney |
10 | Ganoderma lucidum | 2 IUM-0047 | Korea | kidney |
11 | Ganoderma lucidum | IUM-0757 | Korea | kidney |
12 | Ganoderma lucidum | IUM-0938 | Korea | kidney |
13 | Ganoderma lucidum | IUM-3986 | Korea | kidney |
14 | Ganoderma lucidum | IUM-4002 | Korea | kidney |
15 | Ganoderma lucidum | IUM-4100 | Korea | kidney |
16 | Ganoderma lucidum | IUM-4304 | Bangladesh | kidney |
17 | Ganoderma lucidum | IUM-4310 | Bangladesh | kidney |
18 | Ganoderma lucidum | 3 KACC42232 | Japan | kidney |
19 | Ganoderma lucidum | KACC51689 | Japan | kidney |
20 | Ganoderma lucidum | KACC51690 | Japan | kidney |
21 | Ganoderma lucidum | ASI-7037 | Papuanewguinea | kidney |
22 | Ganoderma lucidum | 4 KCTC 16802 | Thailand | kidney |
23 | Ganoderma lucidum | ASI-7068 | USA | kidney |
24 | Ganoderma lucidum | ASI-7152 | Korea | kidney |
25 | Ganoderma lucidum | Commercial strain | Korea | Kideny |
Primer | Sequences (5′—3′) | Target |
---|---|---|
BSM105_F | ATTAGTCGGTCTCGAAGCAAACG | Partial mitochondrial SSU rDNA gene |
BSM173_R | TGCTATGACTTTTGAGATGTTAC | Partial mitochondrial SSU rDNA gene |
URP 1 | ATCCAAGGTCCGAGACAACC | 1 RAPD |
URP 5 | GGCAAGCTGGTGGGAGGTAC | RAPD |
KAGL1_F | GGAGGCCGCTGGACTGAGG | Antler-specific |
KAGL1_R | ATGGGACTGGATCTTGAGGAACA | Antler-specific |
KAGL2_F | GGCGGCGGCAGAGGAGAG | Antler-specific |
KAGL2_R | TCGCGACTTGAGAACTGGCATAGC | Antler-specific |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kwon, O.-C.; Lee, C.-S.; Park, Y.-J. SNP and SCAR Markers for Specific Discrimination of Antler-Shaped Ganoderma lucidum. Microorganisms 2019, 7, 12. https://doi.org/10.3390/microorganisms7010012
Kwon O-C, Lee C-S, Park Y-J. SNP and SCAR Markers for Specific Discrimination of Antler-Shaped Ganoderma lucidum. Microorganisms. 2019; 7(1):12. https://doi.org/10.3390/microorganisms7010012
Chicago/Turabian StyleKwon, O-Chul, Chang-Soo Lee, and Young-Jin Park. 2019. "SNP and SCAR Markers for Specific Discrimination of Antler-Shaped Ganoderma lucidum" Microorganisms 7, no. 1: 12. https://doi.org/10.3390/microorganisms7010012
APA StyleKwon, O.-C., Lee, C.-S., & Park, Y.-J. (2019). SNP and SCAR Markers for Specific Discrimination of Antler-Shaped Ganoderma lucidum. Microorganisms, 7(1), 12. https://doi.org/10.3390/microorganisms7010012