Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains, Media, and Experimental Animals
2.2. Construction of the msbB Deletion Mutant and Its Complementary Strain
2.3. Biofilm Formation
2.4. Morphological Observation and Swarming Motility Analysis
2.5. Outer Membrane Permeabilization Assay and Sensitivity Analysis for Stress and Antibiotics
2.6. Assessment of Strains’ Virulence Using Tetrahymena Model
2.7. Pathogenicity Assay
2.8. Statistical Analysis
3. Results
3.1. Construction of the msbB Deletion Mutant and Growth Assessment
3.2. Loss of msbB Increased the Sensitivity to Stress and Antibiotics
3.3. Loss of msbB Reduced the Swarming Motility of V. parahaemolyticus
3.4. The Virulence of ∆msbB Was Attenuated to Tetrahymena
3.5. Attenuated Pathogenicity of ΔmsbB Strain Against Shrimp
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bai, Y.; Yang, Q.; Sun, Y.; Li, F.; Sun, J.; Yang, S.; Yang, D.; Peng, Z.; Yang, B.; Xu, J.; et al. Antimicrobial susceptibility and genomic characterization of Vibrio parahaemolyticus isolated from aquatic foods in 15 provinces, China, 2020. Int. J. Food Microbiol. 2024, 418, 110737. [Google Scholar] [CrossRef]
- Brumfield, K.D.; Chen, A.J.; Gangwar, M.; Usmani, M.; Hasan, N.A.; Jutla, A.S.; Huq, A.; Colwell, R.R. Environmental Factors Influencing Occurrence of Vibrio parahaemolyticus and Vibrio vulnificus. Appl. Environ. Microbiol. 2023, 89, e0030723. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wang, J.; Chen, J.; Zhang, R.; Zhang, H.; Qi, X.; He, Y. Epidemiological characteristics of Vibrio parahaemolyticus outbreaks, Zhejiang, China, 2010–2022. Front. Microbiol. 2023, 14, 1171350. [Google Scholar] [CrossRef] [PubMed]
- Dubey, S.; Singh, A.; Kumar, B.T.N.; Singh, N.K.; Tyagi, A. Isolation and Characterization of Bacteriophages from Inland Saline Aquaculture Environments to Control Vibrio parahaemolyticus Contamination in Shrimp. Indian J. Microbiol. 2021, 61, 212–217. [Google Scholar] [CrossRef]
- Rezny, B.R.; Evans, D.S. Vibrio parahaemolyticus Infection. In StatPearls; StatPearls Publishing LLC.: St. Petersburg, FL, USA, 2025. [Google Scholar]
- Stratev, D.; Stoyanchev, T.; Bangieva, D. Occurrence of Vibrio parahaemolyticus and Staphylococcus aureus in seafood. Ital. J. Food Saf. 2021, 10, 10027. [Google Scholar] [CrossRef]
- Li, L.; Meng, H.; Gu, D.; Li, Y.; Jia, M. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiol. Res. 2019, 222, 43–51. [Google Scholar] [CrossRef]
- Ghenem, L.; Elhadi, N.; Alzahrani, F.; Nishibuchi, M. Vibrio Parahaemolyticus: A Review on Distribution, Pathogenesis, Virulence Determinants and Epidemiology. Saudi J. Med. Med. Sci. 2017, 5, 93–103. [Google Scholar] [CrossRef]
- Pazhani, G.P.; Chowdhury, G.; Ramamurthy, T. Adaptations of Vibrio parahaemolyticus to Stress During Environmental Survival, Host Colonization, and Infection. Front. Microbiol. 2021, 12, 737299. [Google Scholar] [CrossRef]
- Plaza, N.; Perez-Reytor, D.; Corsini, G.; Garcia, K.; Urrutia, I.M. Contribution of the Type III Secretion System (T3SS2) of Vibrio parahaemolyticus in Mitochondrial Stress in Human Intestinal Cells. Microorganisms 2024, 12, 813. [Google Scholar] [CrossRef]
- Burrell, R. Immunomodulation by bacterial endotoxin. Crit. Rev. Microbiol. 1990, 17, 189–208. [Google Scholar] [CrossRef]
- Brandenburg, K.; Schromm, A.B.; Weindl, G.; Heinbockel, L.; Correa, W.; Mauss, K.; Martinez de Tejada, G.; Garidel, P. An update on endotoxin neutralization strategies in Gram-negative bacterial infections. Expert. Rev. Anti Infect. Ther. 2021, 19, 495–517. [Google Scholar] [CrossRef] [PubMed]
- Osei-Adjei, G.; Huang, X.; Zhang, Y. The extracellular proteases produced by Vibrio parahaemolyticus. World J. Microbiol. Biotechnol. 2018, 34, 68. [Google Scholar] [CrossRef] [PubMed]
- Sheehan, J.R.; Sadlier, C.; O’Brien, B. Bacterial endotoxins and exotoxins in intensive care medicine. BJA Educ. 2022, 22, 224–230. [Google Scholar] [CrossRef]
- Raghunath, P. Roles of thermostable direct hemolysin (TDH) and TDH-related hemolysin (TRH) in Vibrio parahaemolyticus. Front. Microbiol. 2014, 5, 805. [Google Scholar] [CrossRef]
- Raetz, C.R.; Whitfield, C. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 2002, 71, 635–700. [Google Scholar] [CrossRef]
- Swain, P.; Nayak, S.K.; Nanda, P.K.; Dash, S. Biological effects of bacterial lipopolysaccharide (endotoxin) in fish: A review. Fish Shellfish Immunol. 2008, 25, 191–201. [Google Scholar] [CrossRef]
- Ciesielska, A.; Matyjek, M.; Kwiatkowska, K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell Mol. Life Sci. 2021, 78, 1233–1261. [Google Scholar] [CrossRef]
- Whitfield, C.; Trent, M.S. Biosynthesis and export of bacterial lipopolysaccharides. Annu. Rev. Biochem. 2014, 83, 99–128. [Google Scholar] [CrossRef]
- Gryaznova, M.; Burakova, I.; Smirnova, Y.; Morozova, P.; Chirkin, E.; Gureev, A.; Mikhaylov, E.; Korneeva, O.; Syromyatnikov, M. Effect of Probiotic Bacteria on the Gut Microbiome of Mice with Lipopolysaccharide-Induced Inflammation. Microorganisms 2024, 12, 1341. [Google Scholar] [CrossRef]
- Bamba, T.; Matsui, R.; Watabe, K. Effect of steam-heat treatment with/without divalent cations on the inactivation of lipopolysaccharides from several bacterial species. PDA J. Pharm. Sci. Technol. 1996, 50, 129–135. [Google Scholar]
- Fujii, S.; Takai, M.; Maki, T. Wet heat inactivation of lipopolysaccharide from E. coli serotype 055:B5. PDA J. Pharm. Sci. Technol. 2002, 56, 220–227. [Google Scholar] [PubMed]
- Gutsmann, T.; Schromm, A.B.; Brandenburg, K. The physicochemistry of endotoxins in relation to bioactivity. Int. J. Med. Microbiol. 2007, 297, 341–352. [Google Scholar] [CrossRef] [PubMed]
- Raetz, C.R. Bacterial endotoxins: Extraordinary lipids that activate eucaryotic signal transduction. J. Bacteriol. 1993, 175, 5745–5753. [Google Scholar] [CrossRef] [PubMed]
- Ji, F.; Huang, D.; Tan, X.; Guo, Y.; Wang, Z.; Zhou, Q.; Wang, X. Structure analysis of lipid A species in Vibrio parahaemolyticus by constructing mutants lacking multiple secondary acyltransferases of lipid A. Biotechnol. Appl. Biochem. 2023, 70, 716–729. [Google Scholar] [CrossRef]
- Zhou, Q.; Tan, X.; Meng, X.; Wang, J.; Ji, F.; Wang, X. Identification of four secondary acyltransferases for lipid A biosynthesis in Vibrio parahaemolyticus. Biotechnol. Appl. Biochem. 2021, 68, 1486–1500. [Google Scholar] [CrossRef]
- Somerville, J.E., Jr.; Cassiano, L.; Darveau, R.P. Escherichia coli msbB gene as a virulence factor and a therapeutic target. Infect. Immun. 1999, 67, 6583–6590. [Google Scholar] [CrossRef]
- Post, D.M.; Ketterer, M.R.; Phillips, N.J.; Gibson, B.W.; Apicella, M.A. The msbB mutant of Neisseria meningitidis strain NMB has a defect in lipooligosaccharide assembly and transport to the outer membrane. Infect. Immun. 2003, 71, 647–655. [Google Scholar] [CrossRef]
- Low, K.B.; Ittensohn, M.; Le, T.; Platt, J.; Sodi, S.; Amoss, M.; Ash, O.; Carmichael, E.; Chakraborty, A.; Fischer, J.; et al. Lipid A mutant Salmonella with suppressed virulence and TNFalpha induction retain tumor-targeting in vivo. Nat. Biotechnol. 1999, 17, 37–41. [Google Scholar] [CrossRef]
- Claes, A.K.; Steck, N.; Schultz, D.; Zahringer, U.; Lipinski, S.; Rosenstiel, P.; Geddes, K.; Philpott, D.J.; Heine, H.; Grassl, G.A. Salmonella enterica serovar Typhimurium DeltamsbB triggers exacerbated inflammation in Nod2 deficient mice. PLoS ONE 2014, 9, e113645. [Google Scholar] [CrossRef]
- Cobb, J.; Rawson, J.; Gonzalez, N.; Hensel, M.; Kandeel, F.; Husseiny, M.I. Oral Salmonella msbB Mutant as a Carrier for a Salmonella-Based Vaccine for Prevention and Reversal of Type 1 Diabetes. Front. Immunol. 2021, 12, 667897. [Google Scholar] [CrossRef]
- Che, J.; Fang, Q.; Hu, S.; Liu, B.; Wang, L.; Fang, X.; Li, L.; Luo, T.; Bao, B. The Impact of Vp-Porin, an Outer Membrane Protein, on the Biological Characteristics and Virulence of Vibrio Parahaemolyticus. Biology 2024, 13, 485. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Chen, S. A novel adhesive factor contributing to the virulence of Vibrio parahaemolyticus. Sci. Rep. 2015, 5, 14449. [Google Scholar] [CrossRef]
- Pang, M.D.; Lin, X.Q.; Hu, M.; Li, J.; Lu, C.P.; Liu, Y.J. Tetrahymena: An alternative model host for evaluating virulence of Aeromonas strains. PLoS ONE 2012, 7, e48922. [Google Scholar] [CrossRef] [PubMed]
- Douglass, M.V.; Cleon, F.; Trent, M.S. Cardiolipin aids in lipopolysaccharide transport to the gram-negative outer membrane. Proc. Natl. Acad. Sci. USA 2021, 118, e2018329118. [Google Scholar] [CrossRef]
- Murray, S.R.; Bermudes, D.; de Felipe, K.S.; Low, K.B. Extragenic suppressors of growth defects in msbB Salmonella. J. Bacteriol. 2001, 183, 5554–5561. [Google Scholar] [CrossRef] [PubMed]
- Dovala, D.; Rath, C.M.; Hu, Q.; Sawyer, W.S.; Shia, S.; Elling, R.A.; Knapp, M.S.; Metzger, L.E., IV. Structure-guided enzymology of the lipid A acyltransferase LpxM reveals a dual activity mechanism. Proc. Natl. Acad. Sci. USA 2016, 113, E6064–E6071. [Google Scholar] [CrossRef]
- Clements, A.; Tull, D.; Jenney, A.W.; Farn, J.L.; Kim, S.H.; Bishop, R.E.; McPhee, J.B.; Hancock, R.E.; Hartland, E.L.; Pearse, M.J.; et al. Secondary acylation of Klebsiella pneumoniae lipopolysaccharide contributes to sensitivity to antibacterial peptides. J. Biol. Chem. 2007, 282, 15569–15577. [Google Scholar] [CrossRef]
- Larsson, D.G.J.; Flach, C.F. Antibiotic resistance in the environment. Nat. Rev. Microbiol. 2022, 20, 257–269. [Google Scholar] [CrossRef]
- Munita, J.M.; Arias, C.A. Mechanisms of Antibiotic Resistance. Microbiol. Spectr. 2016, 4, 24. [Google Scholar] [CrossRef]
- Zaafrane, S.; Maatouk, K.; Alibi, S.; Ben Mansour, H. Occurrence and antibiotic resistance of Vibrio parahaemolyticus isolated from the Tunisian coastal seawater. J. Water Health 2022, 20, 369–384. [Google Scholar] [CrossRef]
- Wang, T.; Yao, L.; Qu, M.; Wang, L.; Li, F.; Tan, Z.; Wang, P.; Jiang, Y. Whole genome sequencing and antimicrobial resistance analysis of Vibrio parahaemolyticus Vp2015094 carrying an antimicrobial-resistant plasmid. J. Glob. Antimicrob. Resist. 2022, 30, 47–49. [Google Scholar] [CrossRef] [PubMed]
- Elmahdi, S.; DaSilva, L.V.; Parveen, S. Antibiotic resistance of Vibrio parahaemolyticus and Vibrio vulnificus in various countries: A review. Food Microbiol. 2016, 57, 128–134. [Google Scholar] [CrossRef] [PubMed]
- Delcour, A.H. Outer membrane permeability and antibiotic resistance. Biochim. Biophys. Acta 2009, 1794, 808–816. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Rutherford, S.T.; Silhavy, T.J.; Huang, K.C. Physical properties of the bacterial outer membrane. Nat. Rev. Microbiol. 2022, 20, 236–248. [Google Scholar] [CrossRef]
- Konovalova, A.; Mitchell, A.M.; Silhavy, T.J. A lipoprotein/beta-barrel complex monitors lipopolysaccharide integrity transducing information across the outer membrane. eLife 2016, 5, e15276. [Google Scholar] [CrossRef]
- Wang, F.; Deng, L.; Huang, F.; Wang, Z.; Lu, Q.; Xu, C. Flagellar Motility Is Critical for Salmonella enterica Serovar Typhimurium Biofilm Development. Front. Microbiol. 2020, 11, 1695. [Google Scholar] [CrossRef]
- Liu, H.Y.; Prentice, E.L.; Webber, M.A. Mechanisms of antimicrobial resistance in biofilms. npj Antimicrob. Resist. 2024, 2, 27. [Google Scholar] [CrossRef]
- Secor, H.V.; DeBardeleben, J.F. Syntheses and screening of some trifluoromethyl pyrazoles. J. Med. Chem. 1971, 14, 997–998. [Google Scholar] [CrossRef]
- Wang, Z.; Wang, J.; Ren, G.; Li, Y.; Wang, X. Deletion of the genes waaC, waaF, or waaG in Escherichia coli W3110 disables the flagella biosynthesis. J. Basic. Microbiol. 2016, 56, 1021–1035. [Google Scholar] [CrossRef]
- Shen, X.; Yang, Y.B.; Gao, Y.; Wang, S.; Wang, H.; Sun, M.; Meng, F.; Tang, Y.D.; Tu, Y.; Kong, Q.; et al. Lipid A-modified Escherichia coli can produce porcine parvovirus virus-like particles with high immunogenicity and minimal endotoxin activity. Microb. Cell Fact. 2024, 23, 222. [Google Scholar] [CrossRef]
- Zheng, D.; Liwinski, T.; Elinav, E. Inflammasome activation and regulation: Toward a better understanding of complex mechanisms. Cell Discov. 2020, 6, 36. [Google Scholar] [CrossRef] [PubMed]
- Lin, M.C.; Pan, C.Y.; Hui, C.F.; Chen, J.Y.; Wu, J.L. Shrimp anti-lipopolysaccharide factor (SALF), an antimicrobial peptide, inhibits proinflammatory cytokine expressions through the MAPK and NF-kappaB pathways in LPS-induced HeLa cells. Peptides 2013, 40, 42–48. [Google Scholar] [CrossRef] [PubMed]
- Erova, T.E.; Kirtley, M.L.; Fitts, E.C.; Ponnusamy, D.; Baze, W.B.; Andersson, J.A.; Cong, Y.; Tiner, B.L.; Sha, J.; Chopra, A.K. Protective Immunity Elicited by Oral Immunization of Mice with Salmonella enterica Serovar Typhimurium Braun Lipoprotein (Lpp) and Acetyltransferase (MsbB) Mutants. Front. Cell Infect. Microbiol. 2016, 6, 148. [Google Scholar] [CrossRef] [PubMed]
- Yin, X.; Zhuang, X.; Luo, W.; Liao, M.; Huang, L.; Cui, Q.; Huang, J.; Yan, C.; Jiang, Z.; Liu, Y.; et al. Andrographolide promote the growth and immunity of Litopenaeus vannamei, and protects shrimps against Vibrio alginolyticus by regulating inflammation and apoptosis via a ROS-JNK dependent pathway. Front. Immunol. 2022, 13, 990297. [Google Scholar] [CrossRef]
- Zhang, X.; Shi, J.; Sun, Y.; Wang, Y.; Zhang, Z. The potential role of eyestalk in the immunity of Litopenaeus vannamei to Vibrio infection. Fish ShellFish Immunol. 2022, 121, 62–73. [Google Scholar] [CrossRef]
Strains | Genotype and Characteristics | Source |
---|---|---|
V. Parahaemolyticus 17802 | Cms, Kms, Ampr, Wild-type strain | ATCC |
∆msbB | V. parahaemolyticus strain in-frame deletion in msbB | This study |
C∆msbB | The complement of ∆msbB | This study |
Escherichia coli | ||
CC118 | λpir lysogen of CC118 (Δ(ara-leu) araD ΔlacX74galEgalKphoA20 thi-1rpsE rpoB argE (Am) recA1 | Our lab |
CC118/pHelper | CC118 λpir harboring plasmid pHelper | Our lab |
Plasmids | ||
pSR47S | Bacterial allelic exchange vector with sacB, KanR | Our lab |
pSR47S-∆msbB | A 1394 bp fragment encompassing the upstream and downstream regions of the msbB gene in pSR47S, KanR | This study |
pSR47S-C∆msbB | A 2313 bp fragment harboring the msbB sequences in pSR47S, KanR | This study |
Primer Name | Primer Sequence (5′ to 3′) | Purpose |
---|---|---|
UP-F | GCCGCTCTAGAACTAGTGGATCTAACTACGT TCGTCGTCTATGGC | Creation of ∆msbB deletion fusion fragment |
UP-R | CAACTTGCCAGTCAGTGTTGTAGCGTGTCTAT TACCTATCCGTC | |
DOWN-F | GACGGATAGGTAACTAGACACGCTACAACACTGACTGGCAAGTTG | |
DOWN-R | GGATCGATCCTCTAGATCGATGTGTTCA TGGAACTGTGTTGG | |
msbB-H1 | CTCTAGAACTAGTGGATCCGTTGAAGAACGCGAATACGAAG | Creation of C∆msbB fragment |
msbB-H2 | TCGATCCTCTAGAGTCGAGTGCAGCAACTT CGGCATAGTG | |
∆msbB-T1 | GTAGCATCACTTGTTGCCACC | Confirmation of deletion strain |
∆msbB-T2 | GGACATCACCATATCACCAACC | |
C∆msbB-T1 | CGTTGAAGAACGCGAATACGAAG | Confirmation of complementary strain |
C∆msbB-T2 | GTGCAGCAACTTCGGCATAGTG |
Primer Name | Primer Sequence (5′ to 3′) |
---|---|
Liva proPOI-F | ACGTCACTTCCGGCAAGCGA |
Liva proPOI-R | CCTCCTTGTGAGCGTTGTCAGG |
Liva proPO II-F | ACCACTGGCACTGGCACCTCGTCTA |
Liva proPO II-R | TCGCCAGTTCTCGAGCTTCTGCAC |
Liva cytMnSOD-F | TGACGAGAGCTTTGGATCATTCC |
Liva cytMnSOD-R | TGATTTGCAAGGGATCCTGGTT |
CAT-F | ATCCATTCGACCTTACCA |
CAT-R | ACGCAATCTGCTCCACCT |
ACP-F | GTAGCATCACTTGTTGCCACC |
ACP-R | GGACATCACCATATCACCAACC |
IL-1β-F | CATCCCATTTGTGGTTCTG |
IL-1β-R | TCGTGCTTCACTATGCCTC |
β-actin-F | AGTAGCCGCCCTGGTTGT |
β-actin-R | AGGATACCTCGCTTGCTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Che, J.; Liu, B.; Fang, Q.; Hu, S.; Wang, L.; Bao, B. Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus. Microorganisms 2025, 13, 386. https://doi.org/10.3390/microorganisms13020386
Che J, Liu B, Fang Q, Hu S, Wang L, Bao B. Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus. Microorganisms. 2025; 13(2):386. https://doi.org/10.3390/microorganisms13020386
Chicago/Turabian StyleChe, Jinyuan, Binghong Liu, Qitong Fang, Shaojie Hu, Lei Wang, and Baolong Bao. 2025. "Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus" Microorganisms 13, no. 2: 386. https://doi.org/10.3390/microorganisms13020386
APA StyleChe, J., Liu, B., Fang, Q., Hu, S., Wang, L., & Bao, B. (2025). Role of msbB Gene in Physiology and Pathogenicity of Vibrio parahaemolyticus. Microorganisms, 13(2), 386. https://doi.org/10.3390/microorganisms13020386