The Adult and Larva of a New Species of the Genus Dila (Coleoptera, Blaptinae, Blaptini) from Himalayas, with Molecular Phylogenetic Inferences of Related Genera of the Blaptini †
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Morphological Examination
2.2. Taxon Sampling, DNA Extraction, PCR Amplification, and Sequencing
2.3. Phylogenetic Analyses
3. Results
3.1. Morphological Study and Diagnosis
3.1.1. Key to Species of the Genus Dila Fischer von Waldheim, 1844, from China (Based on Males)
- 1.
- The body is slender (Figure 2A) and elongated; the parameres are finger-shaped… 2
- -
- The body is robust and weakly elongated; the parameres are cone-shaped … … … 3
- 2.
- The pronotum is wider than it is long and almost cordiform, with one tooth on theventral margin of the profemur … … … … … … … … D. laevicollis Gebler, 1841
- -
- The pronotum length and width are nearly equal, and the lateral margins show slightarcuate narrowing to the anterior margin, with obtuse-angled prominence of theprofemur … … … … … … … … … … … … … … D. ngaria Li and Ren, sp. n.
- 3.
- The pronotum is wider than it is long and almost cordiform; with two teeth on theventral margin of the profemur, without one tooth on the ventral margin of themesofemur … … … … … … … … … … … … … D. bomina Ren and Li, 2001
- -
- The pronotum length and width are nearly equal, the lateral margins showslight arcuate narrowing to the anterior margin, with one tooth on the ventralmargin of the profemur and without a tooth on the ventral margin of themesofemur … … … … … … … … … … … … … D. rugelytra Ren, 2016
3.1.2. Larva
3.2. Phylogenetic Relationships
3.3. Bionomics
4. Discussion
4.1. Taxonomic Remarks
4.2. Phylogeny and Classification of Species
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Iwan, D.; Löbl, I. Catalogue of Palaearctic Coleoptera; Koninklijke Brill NV: Leiden, The Netherlands, 2020; Volume 5, pp. 1–969. [Google Scholar]
- Chigray, I.A.; Nabozhenko, M.; Abdurakhmanov, G.; Keskin, B. A systematic review of the genus Dila Fischer von Waldheim, 1844 (=Caenoblaps, syn.n.) (Coleoptera: Tenebrionidae) from the Caucasus, Turkey and boundary territories of Iran. Insect Syst. Evol. 2019, 99, 914–923. [Google Scholar]
- Ren, G.D.; Wang, X.P. Eight new species of the genus Blaps Fabricius (Coleoptera: Tenebrionidae: Blaptini) of China. Entomotaxonomia 2001, 1, 15–27. [Google Scholar]
- Löbl, I.; Nabozhenko, M.V.; Merkl, O. Tribe Blaptini Leach, 1815. In Catalogue of Palaearctic Coleoptera; Tenebrionoidea; Löbl, I., Smetana, A., Eds.; Apollo Books: Stenstrup, Denmark, 2008; Volume 5, pp. 219–257. [Google Scholar]
- Reitter, E. Uebersicht der mir bekannten Arten der Coleopteren-Gattung Dila Fisch. Entomol. Nachr. 1900, 26, 295–296. [Google Scholar]
- Blair, K.G. Some new species of Indian Tenebrionidae. Ann. Mag. Nat. Hist. 1913, 12, 56–58. [Google Scholar] [CrossRef]
- Kaszab, Z. Die Tenebrioniden Afghanistans, auf Grand der Ergebnisse der Sammelreise des Herrn, J. Klapperich in den Jahren 1952/53 (Col.). 1. Fortsetzung und Schluss. Entomol. Arb. Dem Mus. G. Frey 1960, 11, 1–179. [Google Scholar]
- Kaszab, Z. Beiträge zur Kenntnis der Fauna Afghanistans (Sammelergebniss von O. Jakeš 1963–64, D. Povolný & Fr. Tenora 1966, J. Šimek 1965–66, D, Povolný, J. Geiser, Z. Šebek & Fr. Tenora 1967). Tenebrionidae, Col. Časopis Morav. Mus. 1970, 54, 5–182. [Google Scholar]
- Reitter, E. Dila leptoscelis n. sp. Entomol. Blätter 1909, 5, 239. [Google Scholar]
- Ren, G.D.; Ba, Y.B.; Liu, H.Y.; Niu, Y.P.; Zhu, X.C.; Li, Z.; Shi, A.M. Coleoptera: Tenebrionidae (I); Fauna Sinica. Insecta; Science Press: Beijing, China, 2016; Volume 63, p. 532. [Google Scholar]
- Semenov-Tian-Schanskij, A.P.; Bogatshev, A.V. Characterized additions to the fauna of the USSR on order Coleoptera, I. Byulleten’. Mosk. Obs. Ispyt. Prir. 1940, 49, 201–209. [Google Scholar]
- Skopin, N.G. Materials on the morphology and ecology of larvae of the tribe Blaptini (Coleoptera, Tenebrionidae). Tr. Inst. Zool. Akad. Nauk. Kazakhskoy SSR 1960, 11, 36–71. [Google Scholar]
- Monteiro, A.; Pierce, N.E. Phylogeny of Bicyclus (Lepidoptera:Nymphalidae) inferred from COI, COII and EF-1α gene sequences. Mol. Phylogenet. Evol. 2001, 18, 264–281. [Google Scholar] [CrossRef]
- Simmons, R.B.; Weller, S.J. Utility and evolution of cytochrome b in insects. Mol. Phylogenet. Evol. 2001, 20, 196–210. [Google Scholar] [CrossRef]
- Simon, C.; Frati, F.; Bekenbach, A.; Crespi, B.; Liu, H.; Flook, P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994, 87, 651–701. [Google Scholar] [CrossRef]
- Belshaw, R.; Quicke, D.L.J. A molecular phylogeny of the Aphidiinae (Hymenoptera: Braconidae). Mol. Phylogenet. Evol. 1997, 7, 281–293. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef]
- Minh, B.Q.; Nguyen, M.A.T.; Von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
- Chigray, I.A. A new genus and species of darkling beetles of the tribe Blaptini (Coleoptera: Tenebrionidae) from Afghanistan and taxonomic changes in the tribe. Entomol. Rev. 2019, 99, 914–923. [Google Scholar] [CrossRef]
- Grebennikov, V.V.; Scholtz, C.H. The basal phylogeny of Scarabaeoidea (Insecta: Coleoptera) inferred from larval morphology. Invertebr. Syst. 2004, 18, 321–348. [Google Scholar] [CrossRef]
- Lawrence, J.F.; Seago, A.E.; Newton, A.F.; Thayer, M.K.; Marvaldi, A.E.; Slipinski, A. Phylogeny of the Coleoptera based on morphological characters of adults and larvae. Ann. Zool. 2011, 61, 1–217. [Google Scholar] [CrossRef]
- Soldati, L.; Condamine, F.L.; Clamens, A.L.; Kergoat, G.J. Documenting tenebrionid diversity: Progress on Blaps Fabricius (Coleoptera, Tenebrionidae, Tenebrioninae, Blaptini) systematics, with the description of five new species. Eur. J. Taxon. 2017, 282, 1–29. [Google Scholar] [CrossRef]
- Watt, J. A revised subfamily classifcation of Tenebrionidae (Coleoptera). N. Z. J. Zool. 1974, 11, 381–452. [Google Scholar] [CrossRef]
- Yu, Y.Z.; Ren, G.D.; Sun, X.Q. Morphology and a key of common larvae of Blaptini in northern China (Coleoptera: Tenebrionidae). Entomol. Knowl. 1996, 33, 198–203. [Google Scholar]
- Yu, Y.Z.; Zhang, D.Z.; Wang, X.P. Morphology description of five larvae (Coleoptera: Tenebrionidae, Blaptini). J. Ningxia Agric. Coll. 1999, 20, 15–20. [Google Scholar]
- Yu, Y.Z.; Zhang, D.Z.; Ren, G.D. Systematic research of the genus Blaps Fabricius-larvae in China (Coleoptera: Tenebrionidae (Part I). J. Hebei Univ. 2000, 20, 94–101. [Google Scholar]
- Zhao, M.; Feng, Y.; Chen, X.M.; Ji, H.H. Morphological and biological characteristics of Blaps rhynchopetera (Coleoptera: Tennbrionidae). J. Environ. Entomol. 2009, 31, 348–355. [Google Scholar]
- Zhu, X.C.; Ren, G.D. The larvae of Gnaptorina felicitana and Agnaptoria amdoensis of the tribe Blaptini from China (Coleoptera: Tenebrionidae). Zool. Syst. 2014, 39, 275–282. [Google Scholar]
- Medvedev, G.S.; Merkl, O. Novye vidy zhukov-chernotelok triby Blaptini (Coleoptera, Tenebrionidae) iz yugo-zapadnogo Kitaya. Entomol Obozr. 2001, 80, 620–626. [Google Scholar]
- Li, X.M.; Tian, J.; Fan, J.J.; Ren, G.D. Systematic Review of the Genus Nalepa Reitter, 1887(Coleoptera, Tenebrionidae, Blaptinae, Blaptini) from the Tibetan Plateau, with Description of Six New Species and Two Larvae. Insects 2022, 13, 598. [Google Scholar] [CrossRef]
- Condamine, F.L.; Soldati, L.; Rasplus, J.Y.; Kergoat, G.J. New insights on systematics and phylogenetics of Mediterranean Blaps species (Coleoptera: Tenebrionidae: Blaptini), assessed through morphology and dense taxon sampling. Syst. Entomol. 2011, 36, 340–361. [Google Scholar] [CrossRef]
Gene | Primer (Forward/Reverse) | Sequence (Forward and Reverse) 5′ → 3′ | PCR Conditions (Annealing) | References |
---|---|---|---|---|
COI | F 2183 | CAACATTTATTTTGATTTTTTGG | 50 °C | Monteiro & Pierce, 2001 [13] |
R 3014 | TCCAATGCACTAATCTGCCATATTA | |||
Cytb | F revcb2h | TGAGGACAAATATCATTTTGAGGW | 50 °C | Simmons et al., 2001 [14] |
R rebcbj | TCAGGTCGAGCTCCAATTCATGT | |||
16S | F 13398 | CGCCTGTTTATCAAAAACAT | 50 °C | Simon et al., 1994 [15] |
R 12887 | CCGGTCTGAACTCAGATCAT | |||
28S-D2 | F 3665 | AGAGAGAGTTCAAGAGTACGTG | 58 °C | Belshaw et al., 1997 [16] |
R 4068 | TTGGTCCGTGTTTCAAGACGGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, X.-M.; Ji, B.; Tian, J.; Ren, G.-D. The Adult and Larva of a New Species of the Genus Dila (Coleoptera, Blaptinae, Blaptini) from Himalayas, with Molecular Phylogenetic Inferences of Related Genera of the Blaptini. Insects 2023, 14, 284. https://doi.org/10.3390/insects14030284
Li X-M, Ji B, Tian J, Ren G-D. The Adult and Larva of a New Species of the Genus Dila (Coleoptera, Blaptinae, Blaptini) from Himalayas, with Molecular Phylogenetic Inferences of Related Genera of the Blaptini. Insects. 2023; 14(3):284. https://doi.org/10.3390/insects14030284
Chicago/Turabian StyleLi, Xiu-Min, Baoyue Ji, Juan Tian, and Guo-Dong Ren. 2023. "The Adult and Larva of a New Species of the Genus Dila (Coleoptera, Blaptinae, Blaptini) from Himalayas, with Molecular Phylogenetic Inferences of Related Genera of the Blaptini" Insects 14, no. 3: 284. https://doi.org/10.3390/insects14030284
APA StyleLi, X.-M., Ji, B., Tian, J., & Ren, G.-D. (2023). The Adult and Larva of a New Species of the Genus Dila (Coleoptera, Blaptinae, Blaptini) from Himalayas, with Molecular Phylogenetic Inferences of Related Genera of the Blaptini. Insects, 14(3), 284. https://doi.org/10.3390/insects14030284