Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio
Abstract
:1. Introduction
2. Materials and Methods
2.1. Informed Consent
2.2. Swab Collection and Preparation
2.3. SARS-CoV-2 RT-qPCR
3. Results
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
SARS-CoV-2 | Severe Acute Respiratory Syndrome Coronavirus 2 |
WHO | World Health Organization |
RT-qPCR | Reverse Transcription-Quantitative Polymerase Chain Reaction |
IVD | For In Vitro Diagnostic use |
IHD | In-House developed |
COVID-19 | Coronavirus Disease of 2019 |
RP | RNAseP gene |
RdRP | RNA-dependent RNA Polymerase gene |
RdRP/Hel | RNA-dependent RNA Polymerase/Helicase gene |
N | Nucleocapsid Protein gene |
E | Envelope gene |
BSL-2 | Biosafety Level 2 |
CDC | Center for Disease Control and Prevention |
References
- Wang, C.; Horby, P.W.; Hayden, F.G.; Gao, G.F. A novel coronavirus outbreak of global health concern. Lancet 2020, 395, 470–473. [Google Scholar] [CrossRef] [Green Version]
- Huang, C.; Wang, Y.; Li, X.; Ren, L.; Zhao, J.; Hu, Y.; Zhang, L.; Fan, G.; Xu, J.; Gu, X.; et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet 2020, 395, 497–506. [Google Scholar] [CrossRef] [Green Version]
- Chan, J.F.; Yuan, S.; Kok, K.H.; To, K.K.; Chu, H.; Yang, J.; Xing, F.; Liu, J.; Yip, C.C.; Poon, R.W.; et al. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: A study of a family cluster. Lancet 2020, 395, 514–523. [Google Scholar] [CrossRef] [Green Version]
- Naik, R.R.; Shakya, A.K. Therapeutic Strategies in the Management of COVID-19. Front. Mol. Biosci. 2021, 7, 636738. [Google Scholar] [CrossRef]
- Seyed Hosseini, E.; Riahi Kashani, N.; Nikzad, H.; Azadbakht, J.; Hassani Bafrani, H.; Haddad Kashani, H. The novel coronavirus Disease-2019 (COVID-19): Mechanism of action, detection and recent therapeutic strategies. Virology 2020, 551, 1–9. [Google Scholar] [CrossRef]
- Tang, Y.W.; Schmitz, J.E.; Persing, D.H.; Stratton, C.W. Laboratory Diagnosis of COVID-19: Current Issues and Challenges. J. Clin. Microbiol. 2020, 58, e00512-20. [Google Scholar] [CrossRef] [Green Version]
- Vandenberg, O.; Martiny, D.; Rochas, O.; van Belkum, A.; Kozlakidis, Z. Considerations for diagnostic COVID-19 tests. Nat. Rev. Microbiol. 2021, 19, 171–183. [Google Scholar] [CrossRef] [PubMed]
- Corman, V.M.; Landt, O.; Kaiser, M.; Molenkamp, R.; Meijer, A.; Chu, D.K.; Bleicker, T.; Brünink, S.; Schneider, J.; Schmidt, M.L.; et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance 2020, 25, 2000045. [Google Scholar] [CrossRef] [Green Version]
- Zhou, Y.; Pei, F.; Ji, M.; Wang, L.; Zhao, H.; Li, H.; Yang, W.; Wang, Q.; Zhao, Q.; Wang, Y. Sensitivity evaluation of 2019 novel coronavirus (SARS-CoV-2) RT-PCR detection kits and strategy to reduce false negative. PLoS ONE 2020, 15, e0241469. [Google Scholar] [CrossRef]
- Yu, F.; Yan, L.; Wang, N.; Yang, S.; Wang, L.; Tang, Y.; Gao, G.; Wang, S.; Ma, C.; Xie, R.; et al. Quantitative Detection and Viral Load Analysis of SARS-CoV-2 in Infected Patients. Clin. Infect. Dis. 2020, 71, 793–798. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Suo, T.; Liu, X.; Feng, J.; Guo, M.; Hu, W.; Guo, D.; Ullah, H.; Yang, Y.; Zhang, Q.; Wang, X.; et al. ddPCR: A more accurate tool for SARS-CoV-2 detection in low viral load specimens. Emerg. Microbes Infect. 2020, 9, 1259–1268. [Google Scholar] [CrossRef] [PubMed]
- Huber, M.; Schreiber, P.W.; Scheier, T.; Audigé, A.; Buonomano, R.; Rudiger, A.; Braun, D.L.; Eich, G.; Keller, D.I.; Hasse, B.; et al. High Efficacy of Saliva in Detecting SARS-CoV-2 by RT-PCR in Adults and Children. Microorganisms 2021, 9, 642. [Google Scholar] [CrossRef]
- Millioni, R.; Mortarino, C. Test Groups, Not Individuals: A Review of the Pooling Approaches for SARS-CoV-2 Diagnosis. Diagnostics 2021, 11, 68. [Google Scholar] [CrossRef] [PubMed]
- Mulu, A.; Alemayehu, D.H.; Alemu, F.; Tefera, D.A.; Wolde, S.; Aseffa, G.; Seyoum, T.; Habtamu, M.; Abdissa, A.; Bayih, A.G.; et al. Evaluation of sample pooling for screening of SARS CoV-2. PLoS ONE 2021, 16, e0247767. [Google Scholar] [CrossRef]
- Sawicki, R.; Korona-Glowniak, I.; Boguszewska, A.; Stec, A.; Polz-Dacewicz, M. Sample pooling as a strategy for community monitoring for SARS-CoV-2. Sci. Rep. 2021, 11, 3122. [Google Scholar] [CrossRef]
- Brault, V.; Mallein, B.; Rupprecht, J.F. Group testing as a strategy for COVID-19 epidemiological monitoring and community surveillance. PLoS Comput. Biol. 2021, 17, e1008726. [Google Scholar] [CrossRef] [PubMed]
- Chan, J.F.; Yip, C.C.; To, K.K.; Tang, T.H.; Wong, S.C.; Leung, K.H.; Fung, A.Y.; Ng, A.C.; Zou, Z.; Tsoi, H.W.; et al. Improved Molecular Diagnosis of COVID-19 by the Novel, Highly Sensitive and Specific COVID-19-RdRp/Hel Real-Time Reverse Transcription-PCR Assay Validated In Vitro and with Clinical Specimens. J. Clin. Microbiol. 2020, 58, e00310-20. [Google Scholar] [CrossRef] [Green Version]
- Jung, Y.; Park, G.S.; Moon, J.H.; Ku, K.; Beak, S.H.; Lee, C.S.; Kim, S.; Park, E.C.; Park, D.; Lee, J.H.; et al. Comparative Analysis of Primer-Probe Sets for RT-qPCR of COVID-19 Causative Virus (SARS-CoV-2). ACS Infect. Dis. 2020, 6, 2513–2523. [Google Scholar] [CrossRef]
- Genoud, V.; Stortz, M.; Waisman, A.; Berardino, B.G.; Verneri, P.; Dansey, V.; Salvatori, M.; Remes Lenicov, F.; Levi, V. Extraction-free protocol combining proteinase K and heat inactivation for detection of SARS-CoV-2 by RT-qPCR. PLoS ONE 2021, 16, e0247792. [Google Scholar] [CrossRef]
- Vogels, C.B.F.; Watkins, A.E.; Harden, C.A.; Brackney, D.E.; Shafer, J.; Wang, J.; Caraballo, C.; Kalinich, C.C.; Ott, I.M.; Fauver, J.R.; et al. SalivaDirect: A simplified and flexible platform to enhance SARS-CoV-2 testing capacity. Med 2021, 2, 263–280.e6. [Google Scholar] [CrossRef]
- Lohse, S.; Pfuhl, T.; Berkó-Göttel, B.; Rissland, J.; Geißler, T.; Gärtner, B.; Becker, S.L.; Schneitler, S.; Smola, S. Pooling of samples for testing for SARS-CoV-2 in asymptomatic people. Lancet Infect. Dis. 2020, 20, 1231–1232. [Google Scholar] [CrossRef]
- Fereidouni, S.R.; Harder, T.C.; Gaidet, N.; Ziller, M.; Hoffmann, B.; Hammoumi, S.; Globig, A.; Starick, E. Saving resources: Avian influenza surveillance using pooled swab samples and reduced reaction volumes in real-time RT-PCR. J. Virol. Methods 2012, 186, 119–125. [Google Scholar] [CrossRef]
- Quinn, T.C.; Brookmeyer, R.; Kline, R.; Shepherd, M.; Paranjape, R.; Mehendale, S.; Gadkari, D.A.; Bollinger, R. Feasibility of pooling sera for HIV-1 viral RNA to diagnose acute primary HIV-1 infection and estimate HIV incidence. Aids 2000, 14, 2751–2757. [Google Scholar] [CrossRef]
- Polvere, I.; Parrella, A.; Casamassa, G.; D’Andrea, S.; Tizzano, A.; Cardinale, G.; Voccola, S.; Porcaro, P.; Stilo, R.; Vito, P.; et al. Seroprevalence of Anti-SARS-CoV-2 IgG and IgM among Adults over 65 Years Old in the South of Italy. Diagnostics 2021, 11, 483. [Google Scholar] [CrossRef]
- Polvere, I.; Voccola, S.; Cardinale, G.; Fumi, M.; Aquila, F.; Parrella, A.; Madera, J.R.; Stilo, R.; Vito, P.; Zotti, T. A peptide-based assay discriminates individual antibody response to SARS-CoV-2. Genes Dis. 2021. [Google Scholar] [CrossRef]
- Huang, Q.; Liu, Z.; Liao, Y.; Chen, X.; Zhang, Y.; Li, Q. Multiplex fluorescence melting curve analysis for mutation detection with dual-labeled, self-quenched probes. PLoS ONE 2011, 6, e19206. [Google Scholar] [CrossRef] [PubMed]
- Koo, J.R.; Cook, A.R.; Park, M.; Sun, Y.; Sun, H.; Lim, J.T.; Tam, C.; Dickens, B.L. Interventions to mitigate early spread of SARS-CoV-2 in Singapore: A modelling study. Lancet Infect. Dis. 2020, 20, 678–688. [Google Scholar] [CrossRef] [Green Version]
- Rauch, J.N.; Valois, E.; Ponce-Rojas, J.C.; Aralis, Z.; Lach, R.S.; Zappa, F.; Audouard, M.; Solley, S.C.; Vaidya, C.; Costello, M.; et al. Comparison of Severe Acute Respiratory Syndrome Coronavirus 2 Screening Using Reverse Transcriptase-Quantitative Polymerase Chain Reaction or CRISPR-Based Assays in Asymptomatic College Students. JAMA Netw. Open 2021, 4, e2037129. [Google Scholar] [CrossRef] [PubMed]
Primer/Probe Name | Sequence (5′→3′) |
---|---|
2019-nCoV_N1-P | [FAM/VIC]ACCCCGCATTACGTTTGGTGGACC[BHQ1] |
2019-nCoV_N1-F | GACCCCAAAATCAGCGAAA |
2019-nCoV_N1-R | TCTGGTTACTGCCAGTTGAATCTG |
hRP-Probe | [HEX]TTCTGACCTGAAGGCTCTGCGCG[BHQ1] |
hRP-F | AGATTTGGACCTGCGAGCG |
hRP-R | GAGCGGCTGTCTCCACAAGT |
RdRP_SARSr-P2 | [CY5]CAGGTGGAACCTCATCAGGAGATGC[BBQ650] |
RdRP_SARSr-F2 | GTGARATGGTCATGTGTGGCGG |
RdRP_SARSr-R1 | CARATGTTAAASACACTATTAGCATA |
Samples | CT Values | Positivity to SARS-CoV-2 | ||||||
---|---|---|---|---|---|---|---|---|
N IVD | N IHD | N IHD POOL | RdRP/HEL IVD | RdRP IHD | RdRP IHD POOL | E IVD | ||
UNI_2409_276 | 25.93 | 25.87 | 27.96 | 26.61 | 38.37 | 34.35 | N/A | Confirmed |
UNI_2809_015 | 30.06 | 24.39 | 20.06 | 27.95 | 32.70 | 30.45 | 30.94 | Confirmed |
UNI_2809_147 | N/A | 33.76 | 28.77 | N/A | 30.15 | 34.82 | N/A | Not confirmed |
UNI_2809_178 | 24.89 | 19.36 | 19.67 | 26.59 | 24.21 | 23.02 | N/A | Confirmed |
UNI_3009_230 | 25.33 | 24.05 | 22.74 | 28.17 | 30.33 | 44.44 | 17.13 | Confirmed |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Polvere, I.; Silvestri, E.; Sabatino, L.; Giacco, A.; Iervolino, S.; Peluso, T.; Guida, R.; Zerillo, L.; Varricchio, R.; D’Andrea, S.; et al. Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio. Diagnostics 2021, 11, 1166. https://doi.org/10.3390/diagnostics11071166
Polvere I, Silvestri E, Sabatino L, Giacco A, Iervolino S, Peluso T, Guida R, Zerillo L, Varricchio R, D’Andrea S, et al. Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio. Diagnostics. 2021; 11(7):1166. https://doi.org/10.3390/diagnostics11071166
Chicago/Turabian StylePolvere, Immacolata, Elena Silvestri, Lina Sabatino, Antonia Giacco, Stefania Iervolino, Teresa Peluso, Rosa Guida, Lucrezia Zerillo, Romualdo Varricchio, Silvia D’Andrea, and et al. 2021. "Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio" Diagnostics 11, no. 7: 1166. https://doi.org/10.3390/diagnostics11071166
APA StylePolvere, I., Silvestri, E., Sabatino, L., Giacco, A., Iervolino, S., Peluso, T., Guida, R., Zerillo, L., Varricchio, R., D’Andrea, S., Voccola, S., Madera, J. R., Zullo, A., Stilo, R., Vito, P., & Zotti, T. (2021). Sample-Pooling Strategy for SARS-CoV-2 Detection among Students and Staff of the University of Sannio. Diagnostics, 11(7), 1166. https://doi.org/10.3390/diagnostics11071166