Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters
Abstract
1. Introduction
2. Materials and Methods
2.1. Identification of Cryptosporidium-Specific Conserved Signature Protein/Gene
2.2. Primer/Probe Design and Specificity Validation
2.3. PCR Assay Development Quality Control Analysis
2.4. PCR Assay Efficiency for Recreational Water DNA Testing
3. Results
3.1. Cryptosporidium-Specific Conserved Signature Protein/Gene
3.2. In Silico and Experimental Validation of Primers/Probe for Cryptosporidium-Specific CSP
3.3. Development of qPCR Assay and Quality Control Analysis
3.4. Application of qPCR Assay for Recreational Water Testing
4. Discussion
5. Conclusions
- Thetaxon-specific hypothetical protein (cgd2_3830) was identified as a Cryptosporidium-specific Conserved Signature Protein (CSP), and in silico and in vitro testing validated its potential as a diagnostic marker for environmental samples.
- The CSP DNA sequence is highly conserved among different Cryptosporidium species and is absent in other species, which is essential for reducing false positives and negatives due to environmental genetic variants.
- The qPCR assay can also be performed in a conventional dye-based format without interference from primer dimer formation, thus avoiding the false positives due to the self-complementarity of primer sequences.
- The developed qPCR assay can detect, as a lower limit, three gene copies in a standard PCR reaction, with high detection sensitivity even in the presence of non-Cryptosporidium complex environmental DNA.
- This proof-of-concept study provides an applicative framework for developing diagnostic strategies using CSP-based DNA markers, which can be extended to the detection/quantification of other microbial pathogens as well.
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- World Health Organization (WHO). Diarrhoeal Disease-Fact Sheet. 2017. Available online: https://www.who.int/news-room/fact-sheets/detail/diarrhoeal-disease (accessed on 1 May 2023).
- Karanis, P.; Kourenti, C.; Smith, H. Waterborne transmission of protozoan parasites: A worldwide review of outbreaks and lessons learnt. J. Water Health 2007, 5, 1–38. [Google Scholar] [CrossRef]
- Shrivastava, A.K.; Kumar, S.; Smith, W.A.; Sahu, P.S. Revisiting the global problem of cryptosporidiosis and recommendations. Trop. Parasitol. 2017, 7, 8–17. [Google Scholar]
- Certad, G.; Viscogliosi, E.; Chabé, M.; Cacciò, S.M. Pathogenic mechanisms of Cryptosporidium and Giardia. Trends Parasitol. 2017, 33, 561–576. [Google Scholar] [CrossRef] [PubMed]
- Caccio, S.M.; Putignani, L. Epidemiology of human cryptosporidiosis. In Cryptosporidium: Parasite and Disease; Springer: Vienna, Austria, 2013; pp. 43–79. [Google Scholar]
- Šlapeta, J. Cryptosporidiosis and Cryptosporidium species in animals and humans: A thirty colour rainbow? Int. J. Parasitol. 2013, 43, 957–970. [Google Scholar] [CrossRef] [PubMed]
- Smith, H.V.; Nichols, R.A. Cryptosporidium: Detection in water and food. Exp. Parasitol. 2010, 124, 61–79. [Google Scholar] [CrossRef] [PubMed]
- Hassan, E.M.; Örmeci, B.; DeRosa, M.C.; Dixon, B.R.; Sattar, S.A.; Iqbal, A. A review of Cryptosporidium spp. and their detection in water. Water Sci. Technol. 2021, 83, 1–25. [Google Scholar] [CrossRef]
- Li, N.; Neumann, N.F.; Ruecker, N.; Alderisio, K.A.; Sturbaum, G.D.; Villegas, E.N.; Chalmers, R.; Monis, P.; Feng, Y.; Xiao, L. Development and evaluation of three real-time PCR assays for genotyping and source tracking Cryptosporidium spp. in water. Appl. Environ. Microbiol. 2015, 81, 5845–5854. [Google Scholar] [CrossRef] [PubMed]
- USEPA Method 1623: Cryptosporidium Giardia in Water by Filtration/IMS/FA. Office of Water, EPA 815-R-05-002. 2012. Available online: https://www.epa.gov/sites/production/files/2015-07/documents/epa-1623.pdf (accessed on 1 January 2023).
- Simmons, O.D., III; Sobsey, M.D.; Schaefer, F.W., III; Francy, D.S.; Nally, R.A.; Heaney, C.D. Evaluation of USEPA method 1622 for detection of Cryptosporidium oocysts in stream waters. J. Am. Water Work. Assoc. 2001, 93, 78–87. [Google Scholar] [CrossRef]
- Khanna, V.; Tilak, K.; Ghosh, A.; Mukhopadhyay, C. Modified negative staining of heine for fast and inexpensive screening of Cryptosporidium, Cyclospora, and Cystoisospora spp. Int. Sch. Res. Not. 2014, 165424. [Google Scholar] [CrossRef]
- Luka, G.S.; Najjaran, H.; Hoorfar, M. On-chip-based electrochemical biosensor for the sensitive and label-free detection of cryptosporidium. Sci. Rep. 2022, 12, 6957. [Google Scholar] [CrossRef]
- Keserue, H.A.; Füchslin, H.P.; Wittwer, M.; Nguyen-Viet, H.; Nguyen, T.T.; Surinkul, N.; Koottatep, T.; Schürch, N.; Egli, T. Comparison of rapid methods for detection of Giardia spp. and Cryptosporidium spp. (oo)cysts using transportable instrumentation in a field deployment. Environ. Sci. Technol. 2012, 46, 8952–8959. [Google Scholar] [CrossRef] [PubMed]
- Fradette, M.S.; Culley, A.I.; Charette, S.J. Detection of Cryptosporidium spp. and Giardia spp. in environmental water samples: A journey into the past and new perspectives. Microorganisms 2022, 10, 1175. [Google Scholar] [CrossRef] [PubMed]
- Sammarro Silva, K.J.; Sabogal-Paz, L.P. Giardia spp. cysts and Cryptosporidium spp. oocysts in drinking water treatment residues: Comparison of recovery methods for quantity assessment. Environ. Technol. 2021, 42, 3144–3153. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.J.; Jung, H.H.; Lee, K. Evaluation of cyst loss in standard procedural steps for detecting of Giardia lamblia and Cryptosporidium parvum in water. Biotechnol. Bioprocess Eng. 2006, 11, 368–371. [Google Scholar] [CrossRef]
- Loiola, S.H.N.; Galvão, F.L.; Santos, B.M.D.; Rosa, S.L.; Soares, F.A.; Inácio, S.V.; Suzuki, C.T.N.; Sabadini, E.; Bresciani, K.D.S.; Falcão, A.X.; et al. Development of new staining procedures for diagnosing Cryptosporidium spp. in fecal samples by computerized image analysis. Microsc. Microanal. 2021, 27, 1518–1528. [Google Scholar] [CrossRef]
- Ruecker, N.J.; Matsune, J.C.; Lapen, D.R.; Topp, E.; Edge, T.A.; Neumann, N.F. The detection of Cryptosporidium and the resolution of mixtures of species and genotypes from water. Infect. Genet. Evol. 2013, 15, 3–9. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, B.; Li, J.; Yu, S.; Zhang, N.; Liu, S.; Zhang, Y.; Li, J.; Ma, N.; Cai, Y.; et al. Development of a quantitative real-time PCR assay for detection of Cryptosporidium spp. infection and threatening caused by Cryptosporidium parvum subtype IIdA19G1 in diarrhea calves from Northeastern China. Vector-Borne Zoonotic Dis. 2021, 21, 179–190. [Google Scholar] [CrossRef]
- Tiwari, A.; Ahmed, W.; Oikarinen, S.; Sherchan, S.P.; Heikinheimo, A.; Jiang, G.; Simpson, S.L.; Greaves, J.; Bivins, A. Application of digital PCR for public health-related water quality monitoring. Sci. Total Environ. 2022, 837, 155663. [Google Scholar] [CrossRef]
- Kishida, N.; Miyata, R.; Furuta, A.; Izumiyama, S.; Tsuneda, S.; Sekiguchi, Y.; Noda, N.; Akiba, M. Quantitative detection of Cryptosporidium oocyst in water source based on 18S rRNA by alternately binding probe competitive reverse transcription polymerase chain reaction (ABC-RT-PCR). Water Res. 2012, 46, 187–194. [Google Scholar] [CrossRef]
- Šlapeta, J. Cryptosporidium: Identification and genetic typing. Curr. Protoc. Microbiol. 2017, 44, 20B-1. [Google Scholar] [CrossRef]
- Gao, B.; Mohan, R.; Gupta, R.S. Phylogenomics and protein signatures elucidating the evolutionary relationships among the gammaproteobacteria. Int. J. Syst. Evol. Microbiol. 2009, 59, 234–247. [Google Scholar] [CrossRef] [PubMed]
- Gupta, R.S.; Mathews, D.W. Signature proteins for the major clades of Cyanobacteria. BMC Evol. Biol. 2010, 10, 24. [Google Scholar] [CrossRef] [PubMed]
- Gupta, R.S.; Mok, A. Phylogenomics and signature proteins for the alpha proteobacteria and its main groups. BMC Microbiol. 2007, 7, 106. [Google Scholar] [CrossRef] [PubMed]
- Gupta, R.S.; Griffiths, E. Chlamydiae-specific proteins and indels: Novel tools for studies. Trends Microbiol. 2006, 14, 527–535. [Google Scholar] [CrossRef]
- Gao, B.; Gupta, R.S. Phylogenetic framework and molecular signatures for the main clades of the phylum Actinobacteria. Microbiol. Mol. Biol. Rev. 2012, 76, 66–112. [Google Scholar] [CrossRef] [PubMed]
- Naushad, H.S.; Lee, B.; Gupta, R.S. Conserved signature indels and signature proteins as novel tools for understanding microbial phylogeny and systematics: Identification of molecular signatures that are specific for the phytopathogenic genera Dickeya, Pectobacterium and Brenneria. Int. J. Syst. Evol. Microbiol. 2014, 64 Pt 2, 366–383. [Google Scholar] [CrossRef]
- Saleem, F.; Li, E.; Edge, T.A.; Tran, K.L.; Schellhorn, H.E. Identification of potential microbial risk factors associated with fecal indicator exceedances at recreational beaches. Environ. Microbiome 2024, 19, 4. [Google Scholar] [CrossRef]
- Gao, B.; Gupta, R.S. Phylogenomic analysis of proteins that are distinctive of Archaea and its main subgroups and the origin of methanogenesis. BMC Genom. 2007, 8, 86. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Lim, J.; Shin, S.G.; Lee, S.; Hwang, S. Design and use of group-specific primers and probes for real-time quantitative PCR. Front. Environ. Sci. Eng. China 2011, 5, 28–39. [Google Scholar] [CrossRef]
- Taylor, S.C.; Nadeau, K.; Abbasi, M.; Lachance, C.; Nguyen, M.; Fenrich, J. The ultimate qPCR experiment: Producing publication quality, reproducible data the first time. Trends Biotechnol. 2019, 37, 761–774. [Google Scholar] [CrossRef] [PubMed]
- Li, E.; Saleem, F.; Edge, T.A.; Schellhorn, H.E. Assessment of crAssphage as a human fecal source tracking marker in the lower Great Lakes. Sci. Total Environ. 2024, 912, 168840. [Google Scholar] [CrossRef] [PubMed]
- United States Environmental Protection Agency (USEPA). Cryptosporidium: Drinking Water Health Advisory; Office of Science and Technology, Office of Water: Washington, DC, USA, 2001. Available online: https://www.epa.gov/sdwa/drinking-water-health-advisories-has (accessed on 1 March 2023).
- Health Canada. Guidelines for Canadian Drinking Water Quality: Guideline Technical Document—Enteric Protozoa: Giardia and Cryptosporidium; Water and Air Quality Bureau, Healthy Environments and Consumer Safety Branch, Health Canada: Ottawa, ON, Canada, 2019; Catalogue No. H144-13/10-2018E-PDF. [Google Scholar]
- Choudhary, A.; Gupta, N.; Ahmad, H.; Mirdha, B.R. Morphological variations on microscopy in oocysts of coccidian parasites: A prospective study from a tertiary care hospital in north India. Microsc. Res. Tech. 2017, 80, 969–972. [Google Scholar] [CrossRef] [PubMed]
- Sammarro Silva, K.J.; Sabogal-Paz, L.P. Analytical challenges and perspectives of assessing viability of Giardia muris cysts and Cryptosporidium parvum oocysts by live/dead simultaneous staining. Environ. Technol. 2022, 43, 60–69. [Google Scholar] [CrossRef] [PubMed]
- Hadfield, S.J.; Robinson, G.; Elwin, K.; Chalmers, R.M. Detection and differentiation of Cryptosporidium spp. in human clinical samples by use of real-time PCR. J. Clin. Microbiol. 2011, 49, 918–924. [Google Scholar] [CrossRef] [PubMed]
- Saleem, F.; Li, E.; Tran, K.L.; Rudra, B.; Edge, T.A.; Schellhorn, H.E.; Gupta, R.S. Utilizing novel Escherichia coli-specific conserved signature proteins for enhanced monitoring of recreational water quality. MicrobiologyOpen 2024, 13, e1410. [Google Scholar] [CrossRef] [PubMed]
- Wong, S.Y.; Paschos, A.; Gupta, R.S.; Schellhorn, H.E. Insertion/deletion-based approach for the detection of Escherichia coli O157: H7 in freshwater environments. Environ. Sci. Technol. 2014, 48, 11462–11470. [Google Scholar] [CrossRef]
- Mthethwa, N.P.; Amoah, I.D.; Reddy, P.; Bux, F.; Kumari, S. Fluorescence and colorimetric LAMP-based real-time detection of human pathogenic Cryptosporidium spp. from environmental samples. Acta Trop. 2022, 235, 106606. [Google Scholar] [CrossRef]
- Ki, J.S. Hypervariable regions (V1–V9) of the dinoflagellate 18S rRNA using a large dataset for marker considerations. J. Appl. Phycol. 2012, 24, 1035–1043. [Google Scholar] [CrossRef]
- Boyle, B.; Dallaire, N.; MacKay, J. Evaluation of the impact of single nucleotide polymorphisms and primer mismatches on quantitative PCR. BMC Biotechnol. 2009, 9, 75. [Google Scholar] [CrossRef] [PubMed]
- Artesi, M.; Bontems, S.; Göbbels, P.; Franckh, M.; Maes, P.; Boreux, R.; Meex, C.; Melin, P.; Hayette, M.P.; Bours, V.; et al. A recurrent mutation at position 26340 of SARS-CoV-2 is associated with failure of the E gene quantitative reverse transcription-PCR utilized in a commercial dual-target diagnostic assay. J. Clin. Microbiol. 2020, 58, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- McIlroy, S.J.; Tillett, D.; Petrovski, S.; Seviour, R.J. Non-target sites with single nucleotide insertions or deletions are frequently found in 16S rRNA sequences and can lead to false positives in fluorescence in situ hybridization (FISH). Environ. Microbiol. 2011, 13, 33–47. [Google Scholar] [CrossRef] [PubMed]
- Thorsen, J.; Brejnrod, A.; Mortensen, M.; Rasmussen, M.A.; Stokholm, J.; Al-Soud, W.A.; Sørensen, S.; Bisgaard, H.; Waage, J. Large-scale benchmarking reveals false discoveries and count transformation sensitivity in 16S rRNA gene amplicon data analysis methods used in microbiome studies. Microbiome 2016, 4, 62. [Google Scholar] [CrossRef] [PubMed]
- Hadfield, S.J.; Pachebat, J.A.; Swain, M.T.; Robinson, G.; Cameron, S.J.; Alexander, J.; Hegarty, M.J.; Elwin, K.; Chalmers, R.M. Generation of whole genome sequences of new Cryptosporidium hominis and Cryptosporidium parvum isolates directly from stool samples. BMC Genom. 2015, 16, 650. [Google Scholar] [CrossRef]
- O’Hara, S.P.; Chen, X.M. The cell biology of Cryptosporidium infection. Microbes Infect. 2011, 13, 721–730. [Google Scholar] [CrossRef]
- Mthethwa, N.P.; Amoah, I.D.; Reddy, P.; Bux, F.; Kumari, S. Development and evaluation of a molecular based protocol for detection and quantification of Cryptosporidium spp. in wastewater. Exp. Parasitol. 2022, 234, 108216. [Google Scholar] [CrossRef]
- Ruiz-Villalba, A.; Ruijter, J.M.; van den Hoff, M.J. Use and misuse of Cq in qPCR data analysis and reporting. Life 2021, 11, 496. [Google Scholar] [CrossRef]
- Robinson, G.; Elwin, K.; Jones, M.; Chalmers, R.M. A comparison of qPCR and microscopy for the detection and enumeration of Cryptosporidium oocysts from drinking water. J. Med. Microbiol. 2023, 72, 001715. [Google Scholar] [CrossRef]
- Mahmudunnabi, R.G.; Pannu, A.S.; Nguyen, N.T.; Stratton, H.M.; Shiddiky, M.J. Avoiding commercial kit-based DNA isolation and purification steps: A rapid method for Cryptosporidium oocyst detection. Sens. Diagn. 2025, 4, 229–238. [Google Scholar] [CrossRef]
- Li, Y.; Deng, F.; Hall, T.; Vesey, G.; Goldys, E.M. CRISPR/Cas12a-powered immunosensor suitable for ultra-sensitive whole Cryptosporidium oocyst detection from water samples using a plate reader. Water Res. 2021, 203, 117553. [Google Scholar] [CrossRef]
- Garafutdinov, R.R.; Galimova, A.A.; Sakhabutdinova, A.R. The influence of quality of primers on the formation of primer dimers in PCR. Nucleosides Nucleotides Nucleic Acids 2020, 39, 1251–1269. [Google Scholar] [CrossRef]
- Wang, H.; Liu, X.; Wang, Y.; Zhang, S.; Zhang, G.; Han, Y.; Li, M.; Liu, L. Spatial and temporal dynamics of microbial community composition and factors influencing the surface water and sediments of urban rivers. J. Environ. Sci. 2023, 124, 187–197. [Google Scholar] [CrossRef]
- Paruch, L.; Paruch, A.M. An Overview of Microbial Source Tracking Using Host-Specific Genetic Markers to Identify Origins of Fecal Contamination in Different Water Environments. Water 2022, 14, 1809. [Google Scholar] [CrossRef]
- Cotner, J.B.; Hall, E.K.; Scott, J.T.; Heldal, M. Freshwater bacteria are stoichiometrically flexible with a nutrient composition similar to seston. Front. Microbiol. 2010, 1, 132. [Google Scholar] [CrossRef]



| Assay Type | Primer/Probe | Sequence (5′-3′) | Size (bp) |
|---|---|---|---|
| qPCR | Forward | GAATTAAGTCRGAACTGATTGC | 146 |
| Reverse | CGAAGAAATTTGCGAATCATCA | ||
| Probe | (FAM *)CTCAACTCAAAATAACAATTCTGTTAGTGA(MGBNFQ *) | ||
| Sanger Sequencing | Forward | TGAGCTTCCGACTGGAATTAAG | 911 |
| Reverse | TTCCTGCAGAGTGTTTATAGAAGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saleem, F.; Li, E.; Tran, K.L.; Bello, S.; Weir, S.; Edge, T.A.; Gupta, R.S.; Schellhorn, H.E. Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters. Water 2025, 17, 2498. https://doi.org/10.3390/w17172498
Saleem F, Li E, Tran KL, Bello S, Weir S, Edge TA, Gupta RS, Schellhorn HE. Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters. Water. 2025; 17(17):2498. https://doi.org/10.3390/w17172498
Chicago/Turabian StyleSaleem, Faizan, Enze Li, Kevin L. Tran, Sarah Bello, Susan Weir, Thomas A. Edge, Radhey S. Gupta, and Herb E. Schellhorn. 2025. "Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters" Water 17, no. 17: 2498. https://doi.org/10.3390/w17172498
APA StyleSaleem, F., Li, E., Tran, K. L., Bello, S., Weir, S., Edge, T. A., Gupta, R. S., & Schellhorn, H. E. (2025). Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters. Water, 17(17), 2498. https://doi.org/10.3390/w17172498

