Next Article in Journal
Mesilla/Conejos-Médanos Basin: U.S.-Mexico Transboundary Water Resources
Next Article in Special Issue
Copepod Diel Vertical Distribution in the Open Southern Adriatic Sea (NE Mediterranean) under Two Different Environmental Conditions
Previous Article in Journal
Isotopic Assessment of Groundwater Salinity: A Case Study of the Southwest (SW) Region of Punjab, India
Previous Article in Special Issue
Mediterranean and Black Sea Monstrilloid Copepods (Copepoda: Monstrilloida): Rediscovering the Diversity of Transient Zooplankters
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 14
Issue 2
10.3390/w14020135
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Description of Aurelia pseudosolida sp. nov. (Scyphozoa, Ulmaridae) from the Adriatic Sea

by
Rade Garić
and
Mirna Batistić
*
Institute for Marine and Coastal Research, University of Dubrovnik, Kneza Damjana Jude 12, 20000 Dubrovnik, Croatia
*
Author to whom correspondence should be addressed.
Water 2022, 14(2), 135; https://doi.org/10.3390/w14020135
Received: 4 November 2021 / Revised: 19 December 2021 / Accepted: 3 January 2022 / Published: 6 January 2022
(This article belongs to the Special Issue Plankton Biodiversity in the Mediterranean Sea)
Browse Figures
Versions Notes

Abstract

:
Until 2021, the genus Aurelia contained eleven described species (WoRMS, 2020), with many genetic species still awaiting a formal description. In 2021, ten new species of Aurelia were described almost solely from genetic data in a novel attempt to use genetic characters as diagnostic characters for species descriptions, leaving seven genetic species still undescribed. Here we present the description of a new Aurelia species from the Adriatic Sea using an integrative taxonomy approach, i.e., employing molecular as well as morphological characteristics in order to describe this new Aurelia species. The species is described based on a single medusa sampled from the town of Rovinj (Croatia), North Adriatic, amidst combined blooms of the ctenophore Mnemiopsis leidy and cnidarian Aurelia solida in the summer of 2020. Based on genetic data, the newly described Aurelia pseudosolida sp. nov. has never been sequenced in any of the previous investigations of the molecular diversity of Aurelia. This is the second species belonging to Discomedusae described from the North Adriatic in little more than half a decade, which could be yet another indication of the susceptibility of the North Adriatic to proliferation of non-indigenous gelatinous species, especially if we take into account historical as well as recent blooms of suspected non-indigenous gelatinous species such as Muggiaea atlantica, Aurelia solida, Mawia benovici and Mnemiopsis leidy.

1. Introduction

Aurelia species are known for their boom and bust population dynamics, when during the bloom (boom) phase they form large swarms affecting ecosystems, fisheries and tourism [1,2,3,4,5]. In the Mediterranean there have been, so far, four recorded species: Aurelia aurita, Aurelia coerulea, Aurelia relicta and Aurelia solida [6]. Aurelia solida is considered a Lessepsian migrant and it has established its populations in the North Adriatic with an annual occurrence [6,7,8]. Aurelia relicta is endemic to the Mljet lakes (Mljet island, South Adriatic) [6,9], while Aurelia aurita has been confirmed from the Black Sea and Bosporus [9]. The fourth species, A. coerulea, is a species confined to coastal areas in the Mediterranean, which have large fluctuations in temperature and salinity [6].
There has been a lot of confusion about how many species of Aurelia there are and if much of the proposed Aurelia species were in fact just forms of few species. The matter was mostly settled with genetic research, which revealed that there are many more Aurelia species than anticipated [7,9], opening yet another Pandora box of cryptic species. Until 2021, there were 12 described Aurelia species [10], out of which 7 were genetically characterized [6,7,11]. In addition to those, there were 11 Aurelia species known solely from their DNA sequences [7,9,11,12,13,14]. In 2021, ten new species of Aurelia were described by Lawley et al. [15], based mostly on genetic characters, leaving behind the traditional need for morphological diagnostic characters in order to describe new species, while four previously undescribed species were resurrected, leaving seven genetic species still undescribed. Here we describe a new species of Aurelia, from a single individual found in the North Adriatic in 2020. The species is morphologically and genetically distinct, with an elaborate morphology of the oral arms of the manubrium as its most prominent feature.

2. Materials and Methods

Aurelia solida and Aurelia pseudosolida sp. nov. specimens were collected on 27 July 2020 in Rovinj (Croatia), 45°05′05.3″ N, 013°38′04.0″ E, using hand nets (Figure 1). During collection, Aurelia solida specimens were counted from the shore in order to estimate their number. Five individuals of Aurelia solida and one individual of Aurelia pseudosolida sp. nov. were collected for genetic and morphological analysis. Due to the peculiar morphology of Aurelia pseudosolida sp. nov., two short videos were made of a living specimen at the time of collection. From each collected animal a part of the tissue was taken for DNA analysis and preserved in 100% acetone, while the rest of the animal was preserved in 10% formalin. From each acetone-preserved tissue sample, approximately 1 mm3 of the tissue was cut and dried at 55 °C for 30 min. After drying, 100 µL of the lysis buffer was added to the dry tissue (98 µL of 10 mM Tris-HCl, pH 8.0, 0.5% of SDS and 0.5 mM of EDTA, with addition of 2 µL of Proteinase K, 20 mg mL−1) and incubated for 2 h at 55 °C with occasional shaking. After lysis, the lysate was mixed with 50 µL of ammonium acetate (7.5 M) and put on +4 °C for half an hour to precipitate the proteins. The samples were centrifuged for 6 min at 12,000 g and the supernatant was transferred to new tubes, while the white precipitate was discarded. To each sample 1 µL of glycogen (20 mg mL−1) was added to help to precipitate DNA, followed by the addition of 120 µL of isopropanol and subsequently mixed by flicking the tubes 20 times. After the centrifugation step of 10 min at 12,000 g, isopropanol was poured out of the tube while the DNA pellet was left at the bottom. The DNA pellet was washed with 300 µL of 70% ethanol by inverting the tube 20 times. After the washing step, the tube was centrifuged 3 min at 12,000 g, the ethanol was discarded, and the pellet was air-dried. After drying, the DNA pellet was dissolved in 50 µL of TE buffer [16,17].
Three regions were PCR-amplified and sequenced: 18S-ITS1-5.8S-ITS2-28S, mitochondrial subunit I of cytochrome oxidase (COI) and mitochondrial 16S. The18S-ITS1-5.8S-ITS2-28S region was sequenced using four overlapping fragments amplified with the following primer pairs: app2f-omm1100r (sequenced by internal primers oiko800r and aur550f), 500f-n1800r (sequenced by internal primers aur750f and 1300f), its5-ilits2r (sequenced by internal primers aur58sr and aur28s200r) and 28sinf-28sr (sequenced by primer 28sinf and internal primer aur28s600r) (Table 1). Mitochondrial subunit I of cytochrome oxidase was sequenced using the primer pair LCO1490-HCO2198, and 16S was sequenced using primer pair SHB-SHA2 (Table 1).
The PCR was performed in a 25 μL PCR mix containing 1× PCR buffer, 0.2 mM of each dNTP, 3 mM MgCl2, 0.2 μM of each primer, 1.2 U of Taq polymerase (NEB #M0273) and 0.5 μL of template DNA. All amplifications except for COI were performed using the same PCR programme with a 2 min denaturation step at 94 °C, followed by 40 cycles of 94 °C for 15 s, 50 °C for 30 s, 68 °C for 1 min and a final extension step at 68 °C for 7 min. The COI fragment was amplified using a PCR programme with a 2 min denaturation step at 94 °C, followed by 40 subsequent cycles of 94 °C for 20 s, 45 °C for 1 min, 68 °C for 1.5 min and a final extension step at 68 °C for 5 min. PCR products were sequenced by the company Macrogen. The obtained sequences were assembled in BioEdit (Ibis Biosciences). All obtained sequences were deposited at GenBank.
In total, 38 mitochondrial 16S rRNA sequences and 35 nuclear ITS1-5.8S sequences were used for the phylogenetic reconstruction. Two sequences were obtained in this study while others were obtained from GenBank. The alignments were made using MAFFT online service with the G-INS-1 method [25] (Alignments S1 and S3). Divergent and ambiguously aligned blocks were removed from the resulting alignments using Gblocks V0.91b [26] (Alignments S2 and S4), using the minimum number of sequences for a conserved position 20, minimum number of sequences for a flanking position 32, maximum number of contiguous nonconserved positions 8, minimum length of a block 5 and allowed gap position of a half. Phylogenetic analysis was performed using the maximum likelihood method in MEGAX [27]. GTR + G was selected as the optimal model of evolution for the 16S phylogeny, based on model selection tool implemented in MEGAX, and four discrete gamma categories were chosen. For the ITS1-5.8S phylogeny, T92 + G was chosen as the best model of evolution, with four discrete gamma categories. The resulting trees were tested by 1000 bootstrap replicates.
COI sequences of all the available described and genetic Aurelia species were aligned using ClustalW [28] (Alignment S5) and the K2P distance was calculated in MEGAX between Aurelia pseudosolida sp. nov. and other available Aurelia COI sequences in GenBank (Table S1), in order to determine if the distance between them is more than the expected species gap [29].

3. Results

3.1. Collected Material

About 1750 m of nearshore water in the town of Rovinj on 27 July 2020 was visually examined from the shore (Figure 1). In total, 275 individuals of Aurelia solida were recorded and one female individual of Aurelia pseudosolida sp. nov. At the same time a bloom of the ctenophore Mnemiopsis leidy was recorded (Figure 2). The Aurelia solida individuals were largely lethargic with very thick and firm mesoglea, thick and firm manubrium arms and with loss of marginal tentacles. One single specimen of Aurelia solida was found in good shape and condition (isolate ASP1), which was used for comparison to the Aurelia pseudosolida sp. nov. individual (isolate ASP2). The collected individual of Aurelia pseudosolida sp. nov. was in perfect condition, actively swimming (Videos S1 and S2) with the manubrium and with oral arms yellow from the numerous attached planulae.

3.2. DNA Analysis

Sequences of the COI, 18S-ITS1-5.8S-ITS2-28S and 16S regions were obtained from five Aurelia solida individuals and one Aurelia pseudosolida sp. nov. individual. The sequences were deposited in GenBank under accession numbers MZ782091-MZ782096 (COI), MZ788652-MZ788653 (18S-ITS1-5.8S-ITS2-28S) and MZ788654-MZ788659 (16S), out of which sequences under the accession numbers MZ782092, MZ788652 and MZ788655 belong to Aurelia pseudosolida sp. nov. (Table 2).
Phylogenetic analysis based on the 16S rRNA gene fragment showed that genus Aurelia contains two major clades (Figure 3). One clade is comprised of species Aurelia sp. 12, Aurelia sp. 13, Aurelia mianzani, Aurelia marginalis, Aurelia rara, Aurelia montyi, Aurelia smithsoniana and Aurelia cebimarensis, while majority of species are placed in another clade. The relationships between species within the clades are largely with low bootstrap supports. The ITS1-5.8S phylogeny also positions Aurelia pseudosolida sp. nov. as a distinct clade within other Aurelia species (Figure 3). When compared to other Aurelia species, the smallest COI K2P distance is between Aurelia pseudosolida sp. nov. and Aurelia hyalina, which is 0.14. The largest found K2P distance, 0.27, is between Aurelia pseudosolida sp. nov. and Aurelia montyi, Aurelia ayla, Aurelia mozambica and Aurelia sp. 9 (Table S1).

3.3. Species Description

Subclass: Discomedusae Haeckel, 1880.
Family: Ulmaridae Haeckel, 1880.
Genus: Aurelia Lamarck, 1816.
Aurelia pseudosolida Garić & Batistić sp. nov.
Figure 4, Figure 5 and Figure 6.
Material examined: One female specimen (holotype) collected at the surface in the town of Rovinj on 27 July 2020 at the coordinates 45°05′05.3″ N and 13°38′04.4″ E. The specimen is deposited in the Natural History Museum Dubrovnik (Dubrovnik, Croatia) under the inventory number PMD-2414.
Holotype: The bell is circular, dome shaped, with eight equally spaced rhopalia. Mesogleia thickness is 11 mm. The species is characterized by 8 indentations at each of 8 rhopalia and 8 smaller, secondary indentations midway between the rhopalia, making in total 16 velar lobes (Figure 4). The rhopalium is covered with a beak-shaped hood, which together with the rhopaliar lappets remind of a cephalopod beak (Figure 5E and Figure 6C). The rhopalium has pronounced rhopaliar lappets with a sensory organ at a variable angle from nearly 90° to 45° in relation to the bell surface. Only an ectodermal ocellus is present with pigment granules forming two bent stripes (Figure 6A,B). There is a relatively low number of large tentacles (on average 43 per quadrant) at the bell margin. The estimated bell diameter is 49 mm (the medusa was not relaxed so the bell diameter was estimated). The mesoglea is thick. The distance between the most proximate points of the opposite gastric cavities is 7.6 mm, while the distance between most distal points of the opposite gastric cavities is 21.8 mm. The subgenital pore diameter is 2 mm (Figure 5B).
Publication LSID: http://zoobank.org/E762EA9D-FF4F-496D-8B29-BA5D34D0C943.
Diagnosis: The oral arms are the most distinguishing feature of this species. They are very folded, in a zig-zag manner, along the proximodistal axis and towards the inner side of the bell (Figure 5D). The oral arms contain large brooding chambers in the form of lacunae of the oral arms, which contain numerous yellow planulae (Figure 5C,D), unlike the oral arms of Aurelia solida, which contain leaf-like structures (Figure 7E,F). The oral arms are very stiff in the proximal and medial part and get loose only at the distal part that does not contain brooding chambers. The species resembles Aurelia labiata in the pyramidal shape of the manubrium and backward-hanging oral arms. The gonads are yellowish. The species possesses a relatively low number of large tentacles, about 43 per quadrant, unlike about the 80 small tentacles per quadrant of Aurelia solida (isolate ASP1). The sensory organ of the rhopalium is as in Aurelia solida. The gonads are horseshoe shaped, unlike in Aurelia solida, which possesses tear (or pear)-shaped gonads (Figure 7A). Aurelia pseudosolida sp. nov. possesses few anastomoses and all the canals are anastomosed. Since Aurelia pseudosolida sp. nov. is genetically distinct from all the so-far sequenced Aurelia species, it is important to establish its difference from unsequenced Aurelia species; so far, those are only A. maldivensis, A. colpota and A. vitiana. Aurelia pseudosolida sp. nov. possesses a single origin of interradial canals per quadrant (Figure 5A) while A. solida, A. maldivensis [30] and Aurelia colpota [31] have multiple origins. Aurelia vitiana seems to have a single origin of interradial canals per quadrant, the same as Aurelia pseudosolida sp. nov., but based on drawings by Agassiz and Mayer [32] it possesses quite simple oral arms and about 65 tentacles per quadrant.
Etymology: Aurelia pseudosolida sp. nov. is named after Aurelia solida, since it has been found in the middle of bloom of Aurelia solida.

4. Discussion

Given the fact that we found only one individual of Aurelia pseudosolida sp. nov., extensive genetic (mitochondrial and nuclear) and morphological data were given to firmly confirm its establishment as a new species. All the data corroborate the distinctiveness of Aurelia pseudosolida sp. nov. Both 16S and ITS1-5.8S phylogenies position Aurelia pseudosolida sp. nov. as a distinctive clade within the genus Aurelia. K2P distances of COI show that the closest distance between Aurelia pseudosolida sp. nov. and another Aurelia species is between Aurelia pseudosolida sp. nov. and Aurelia hyalina, this being 0.14. Such a K2P distance is about 2.5 times larger than the largest within-species K2P distance in a medusozoan, as found by Ortman et al. [29]. Such a K2P distance represents further firm evidence of Aurelia pseudosolida sp. nov. being a new species of Aurelia. In previous investigations, much importance was put on continuous morphometric characters as an objective means of species delimitation among Aurelia species, while meristic characters fell slightly out of focus [6,11]. Such an approach can be valuable when many individuals of an unidentified population are available or when unique meristic or qualitative characters, which can be used for species delimitation, are not present; however, regarding time consumption, it can easily approach genetic techniques. On the other hand, one single, unique distinctive qualitative character is invaluable in the quick determination of a species. With this in mind, we provided detailed photographs of Aurelia pseudosolida sp. nov., with emphasis on the manubrium arms. The distinctive morphology of the manubrium arms was not considered in much detail in recent descriptions of Aurelia species [6,11], but in the case of Aurelia pseudosolida sp. nov. and Aurelia solida it can be used for quick determination of these species in the Adriatic. For 20 years many Aurelia species were only known as genetic species. Without a systematic attempt to characterize them morphologically, no formal description could be made. In 2021, Lawley et al. [15] decided to promote genetic characters as identification characters for species description. The argument was made that a combination of continuous morphometric and meristic characters was not sufficient to delimit Aurelia species, which are prone to morphological variability [15]. This approach was positive in a way that formal names are given to sequences, which would help metabarcoding studies, but for practical field work it will still require a follow-up string of papers that would need to try to find appropriate meristic or qualitative characters for quick species determination; otherwise, every individual of such species would take days or weeks to determine based on its genetic sequence.
Aurelia pseudosolida sp. nov. was found in the North Adriatic amongst combined blooms of Aurelia solida and Mnemiopsis leidy in summer 2020. The North Adriatic is the most productive area of the Adriatic sea [33] and it is known for recurring blooms of gelatinous organisms [34]. In recent decades there have been occurrences of blooms of non-indigenous species in the North Adriatic, such as bloom of Muggiaea atlantica in 1997 [35], Mawia benovici in 2013 [36], Mnemiopsis leidy in 2016 [37] and 2017 [38], and onwards. The exact moment of arrival of Aurelia solida in the North Adriatic is unknown but it is currently considered to be a likely Lessepsian migrant [6,7,8]. First proof of Aurelia solida being the blooming Aurelia in the North Adriatic was given by Ramšak et al. in 2012 [8]. Aurelia solida occurs every year in the North Adriatic with a different magnitude of occurrence [39]. The Adriatic Sea is influenced by decadal changes in circulation regimes in the Ionian, which affect the advection of water masses of different properties as well as the arrival of non-indigenous organisms [40,41]. Such a dynamic nature of the exchange of water masses might partially explain the bloom dynamics of gelatinous species in the North Adriatic [42] as well as the relatively large number of newly described gelatinous zooplankton species in such a well-investigated basin [36,43,44]. It seems that the North Adriatic might be one of the Mediterranean hotspots where non-indigenous gelatinous species can bloom and be more easily detected. With this in mind, the finding of a single individual of another new species of gelatinous zooplankton of unknown ecology and blooming potential calls for continuous monitoring of the North Adriatic as a sensitive area of the Adriatic Sea.
The description of Aurelia pseudosolida sp. nov. and, recently, Aurelia mozambica [11], Aurelia ayla and Aurelia insularia [15], indicate that the diversity of the genus Aurelia is likely much larger than currently known. Due to the fact that Aurelia polyps can be transported by ships, it is to be expected that more and more gelatinous species would be found in hotspot areas such as the North Adriatic, where non-indigenous species can reach higher numbers, which would enable their detection.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/w14020135/s1, Alignment S1: 16S alignment, Alignment S2: 16S alignment gblocks refined, Alignment S3: ITS1-5.8S alignment, Alignment S4: ITS1-5.8S alignment gblocks refined, Alignment S5: COI alignment, Table S1: K2P distances between available Aurelia COI sequences, Video S1: Aurelia pseudosolida sp. nov. swimming, Video S2: Aurelia pseudosolida sp. nov. swimming.

Author Contributions

Specimen collection, genetic analysis, R.G.; morphological analysis, species description, writing, R.G and M.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Croatian Science Foundation, under projects DiVMAd (IP-2019-04-9043) and SpaTeGen (UIP-2020-02-3907).

Data Availability Statement

The data presented in this study are available in the Supplementary Material.

Acknowledgments

We would like to thank the Laboratory for evolutionary ecology, Center for marine research (CIM), Ruđer Bošković Institute, for logistic support, as the material for the study was collected during our visit to the CIM.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Purcell, J.E. Predation on Zooplankton by Large Jellyfish, Aurelia Labiata, Cyanea Capillata and Aequorea Aequorea, in Prince William Sound, Alaska. Mar. Ecol. Prog. Ser. 2003, 246, 137–152. [Google Scholar] [CrossRef][Green Version]
  2. Purcell, J.E. Predation on Fish Eggs and Larvae by Pelagic Cnidarians and Ctenophores. Bull. Mar. Sci. 1985, 37, 739–755. [Google Scholar]
  3. Purcell, J.E.; Sturdevant, M.V. Prey Selection and Dietary Overlap among Zooplanktivorous Jellyfish and Juvenile Fishes in Prince William Sound, Alaska. Mar. Ecol. Prog. Ser. 2001, 210, 67–83. [Google Scholar] [CrossRef][Green Version]
  4. Ghermandi, A.; Galil, B.; Gowdy, J.; Nunes, P.A.L.D. Jellyfish Outbreak Impacts on Recreation in the Mediterranean Sea: Welfare Estimates from a Socioeconomic Pilot Survey in Israel. Mar. Econ. Policy Relat. Ecosyst. Serv. Lessons World’s Reg. Seas. 2015, 11, 140–147. [Google Scholar] [CrossRef]
  5. Kim, D.-H.; Seo, J.-N.; Yoon, W.-D.; Suh, Y.-S. Estimating the Economic Damage Caused by Jellyfish to Fisheries in Korea. Fish. Sci. 2012, 78, 1147–1152. [Google Scholar] [CrossRef]
  6. Scorrano, S.; Aglieri, G.; Boero, F.; Dawson, M.N.; Piraino, S. Unmasking Aurelia Species in the Mediterranean Sea: An Integrative Morphometric and Molecular Approach. Zool. J. Linn. Soc. 2017, 180, 243–267. [Google Scholar] [CrossRef]
  7. Schroth, W.; Jarms, G.; Streit, B.; Schierwater, B. Speciation and Phylogeography in the Cosmopolitan Marine Moon Jelly, Aurelia Sp. BMC Evol. Biol. 2002, 2, 1. [Google Scholar] [CrossRef] [PubMed][Green Version]
  8. Ramšak, A.; Venko, K.; Malej, A. Comparative Phylogeography of Meroplanktonic Species, Aurelia Spp. and Rhizostoma Pulmo (Cnidaria: Scyphozoa) in European Seas. Hydrobiologia 2012, 690, 69–80. [Google Scholar] [CrossRef]
  9. Dawson, M.N.; Jacobs, D.K. Molecular Evidence for Cryptic Species of Aurelia Aurita (Cnidaria, Scyphozoa). Biol. Bull. 2001, 200, 92–96. [Google Scholar] [CrossRef][Green Version]
  10. Collins, A.G.; Jarms, G.; Morandini, A.C. World List of Scyphozoa. Aurelia Lamarck. 1816. Available online: https://www.marinespecies.org/aphia.php?p=taxdetails&id=135263 (accessed on 4 November 2021).
  11. Brown, M.; Scorrano, S.; Kuplik, Z.; Kuyper, D.; Ras, V.; Thibault, D.; Engelbrecht, A.; Gibbons, M.J. A New Macromedusa from the Coast of Mozambique: Aurelia Mozambica sp. nov. (Scyphozoa: Ulmaridae). Zootaxa 2021, 4933, 263–276. [Google Scholar] [CrossRef]
  12. Gershwin, L. Systematics and Biogeography of the Jellyfish Aurelia Labiata (Cnidaria: Scyphozoa). Biol. Bull. 2001, 201, 104–119. [Google Scholar] [CrossRef]
  13. Dawson, M.N.; Gupta, A.S.; England, M.H. Coupled Biophysical Global Ocean Model and Molecular Genetic Analyses Identify Multiple Introductions of Cryptogenic Species. Proc. Natl. Acad. Sci. USA 2005, 102, 11968. [Google Scholar] [CrossRef] [PubMed][Green Version]
  14. Gómez Daglio, L.; Dawson, M.N. Species Richness of Jellyfishes (Scyphozoa: Discomedusae) in the Tropical Eastern Pacific: Missed Taxa, Molecules, and Morphology Match in a Biodiversity Hotspot. Invertebr. Syst. 2017, 31, 635–663. [Google Scholar] [CrossRef]
  15. Lawley, J.W.; Gamero-Mora, E.; Maronna, M.M.; Chiaverano, L.M.; Stampar, S.N.; Hopcroft, R.R.; Collins, A.G.; Morandini, A.C. The Importance of Molecular Characters When Morphological Variability Hinders Diagnosability: Systematics of the Moon Jellyfish Genus Aurelia (Cnidaria: Scyphozoa). PeerJ 2021, 9, e11954. [Google Scholar] [CrossRef] [PubMed]
  16. Slusarenko, A.J. A Rapid Miniprep for the Isolation of Total DNA from Agrobacterium Tumefaciens. Plant Mol. Biol. Report. 1990, 8, 249–252. [Google Scholar] [CrossRef]
  17. Osterburg, H.H.; Allen, J.K.; Finch, C.E. The Use of Ammonium Acetate in the Precipitation of Ribonucleic Acid. Biochem. J. 1975, 147, 367–368. [Google Scholar] [CrossRef][Green Version]
  18. Medlin, L.; Elwood, H.J.; Stickel, S.; Sogin, M.L. The Characterization of Enzymatically Amplified Eukaryotic 16S-like RRNA-Coding Regions. Gene 1988, 71, 491–499. [Google Scholar] [CrossRef][Green Version]
  19. White, T.; Bruns, T.; Lee, S.; Taylor, J. Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In PCR Protocols: A Guide to Methods and Applications; Innis, M., Gelfand, D., Sninsky, J., White, T., Eds.; Academic Press, Inc.: San Diego, CA, USA, 1990; pp. 315–322. [Google Scholar]
  20. Ye, W.; Zeng, Y.; Kerns, J. Molecular Characterisation and Diagnosis of Root-Knot Nematodes (Meloidogyne Spp.) from Turfgrasses in North Carolina, USA. PLoS ONE 2015, 10, e0143556. [Google Scholar] [CrossRef][Green Version]
  21. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  22. Cunningham, C.W.; Buss, L.W. Molecular Evidence for Multiple Episodes of Paedomorphosis in the Family Hydractiniidae. Biochem. Syst. Ecol. 1993, 21, 57–69. [Google Scholar] [CrossRef]
  23. Schuchert, P. Species Boundaries in the Hydrozoan Genus Coryne. Mol. Phylogenet. Evol. 2005, 36, 194–199. [Google Scholar] [CrossRef]
  24. Batistić, M.; Garić, R. The Case of Bougainvillia Triestina Hartlaub 1911 (Hydrozoa, Cnidaria): A 100-Year-Long Struggle for Recognition. Mar. Ecol. 2016, 37, 145–154. [Google Scholar] [CrossRef]
  25. Katoh, K.; Rozewicki, J.; Yamada, K.D. MAFFT Online Service: Multiple Sequence Alignment, Interactive Sequence Choice and Visualization. Brief. Bioinform. 2019, 20, 1160–1166. [Google Scholar] [CrossRef] [PubMed][Green Version]
  26. Castresana, J. Selection of Conserved Blocks from Multiple Alignments for Their Use in Phylogenetic Analysis. Mol. Biol. Evol. 2000, 17, 540–552. [Google Scholar] [CrossRef] [PubMed][Green Version]
  27. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  28. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed][Green Version]
  29. Ortman, B.D.; Bucklin, A.; Pagès, F.; Youngbluth, M. DNA Barcoding the Medusozoa Using MtCOI. Species Divers. Mar. Zooplankton 2010, 57, 2148–2156. [Google Scholar] [CrossRef]
  30. Bigelow, H.B. Medusae from the Maldive Islands. Bull. Mus. Comp. Zool. Harv. Coll. 1904, 39, 245–269. [Google Scholar]
  31. Brandt, J.-F. Prodromus Descriptionis Animalium Ab H. Mertensio Observatorum: Fascic. I. Polypos, Acalephas Discophoras et Siphonophoras, Nec Non Echinodermata Continens. Recueil des Actes de la Séance Publique de l’Académie Impériale des Sciences de St. Pétersbourg 1835, 1834, 201–275. [Google Scholar]
  32. Agassiz, A.; Mayer, A.G. Acalephs from the Fiji Islands. Bull. Mus. Comp. Zoöl. Harv. Coll. 1899, 32, 157–189. [Google Scholar]
  33. Benović, A.; Fonda-Umani, S.; Malej, A.; Specchi, M. Net-Zooplankton Biomass of the Adriatic Sea. Mar. Biol. 1984, 79, 209–218. [Google Scholar] [CrossRef]
  34. Kogovšek, T.; Bogunović, B.; Malej, A. Recurrence of Bloom-Forming Scyphomedusae: Wavelet Analysis of a 200-Year Time Series. Hydrobiologia 2010, 645, 81–96. [Google Scholar] [CrossRef]
  35. Kršinić, F.; Njire, J. An Invasion by Muggiaea Atlantica Cunningham 1892 in the Northern Adriatic Sea in the Summer of 1997 and the Fate of Small Copepods. Acta Adriat. 2001, 42, 49–59. [Google Scholar]
  36. Piraino, S.; Aglieri, G.; Martell, L.; Mazzoldi, C.; Melli, V.; Milisenda, G.; Scorrano, S.; Boero, F. Pelagia Benovici sp. nov. (Cnidaria, Scyphozoa): A New Jellyfish in the Mediterranean Sea. Zootaxa 2014, 3794, 455–468. [Google Scholar] [CrossRef] [PubMed][Green Version]
  37. Malej, A.; Tirelli, V.; Lučić, D.; Paliaga, P.; Vodopivec, M.; Goruppi, A.; Ancona, S.; Benzi, M.; Bettoso, N.; Camatti, E.; et al. Mnemiopsis Leidyi in the Northern Adriatic: Here to Stay? J. Sea Res. 2017, 124. [Google Scholar] [CrossRef]
  38. Fiori, E.; Benzi, M.; Ferrari, C.R.; Mazziotti, C. Zooplankton Community Structure before and after Mnemiopsis Leidyi Arrival. J. Plankton Res. 2019, 41, 803–820. [Google Scholar] [CrossRef]
  39. Malej, A.; Kogovšek, T.; Ramšak, A.; Catenacci, L. Blooms and Population Dynamics of Moon Jellyfish in the Northern Adriatic. Cah. Biol. Mar. 2012, 53, 337–342. [Google Scholar]
  40. Batistić, M.; Garić, R.; Molinero, J.C. Interannual Variations in Adriatic Sea Zooplankton Mirror Shifts in Circulation Regimes in the Ionian Sea. Clim. Res. 2014, 61, 231–240. [Google Scholar] [CrossRef]
  41. Gačić, M.; Borzelli, G.L.E.; Civitarese, G.; Cardin, V.; Yari, S. Can Internal Processes Sustain Reversals of the Ocean Upper Circulation? The Ionian Sea Example. Geophys. Res. Lett. 2010, 37. [Google Scholar] [CrossRef]
  42. Civitarese, G.; Gačić, M.; Lipizer, M.; Eusebi Borzelli, G.L. On the Impact of the Bimodal Oscillating System (BiOS) on the Biogeochemistry and Biology of the Adriatic and Ionian Seas (Eastern Mediterranean). Biogeosciences 2010, 7, 3987–3997. [Google Scholar] [CrossRef][Green Version]
  43. Garić, R.; Batistić, M. Description of Brooksia Lacromae sp. nov. (Tunicata, Thaliacea) from the Adriatic Sea. Eur. J. Taxon. 2016, 196. [Google Scholar] [CrossRef][Green Version]
  44. Garić, R.; Batistić, M. Fritillaria Ragusina sp. nov., a New Species of Appendicularia (Tunicata) from the Adriatic Sea. J. Mar. Biol. Assoc. UK 2011, 91, 555–559. [Google Scholar] [CrossRef]
Water 14 00135 g001 550
Figure 1. (A) Location of the collection of Aurelia pseudosolida sp. nov. in the town of Rovinj (red dot on the left figure). Dark blue lines denote part of the coast visually examined from the shore for Aurelia medusae. In total, 1750 m of shore was examined and 275 individuals of Aurelia solida were found and one individual of Aurelia pseudosolida sp. nov. (B) Location of the town of Rovinj (red dot pointed to by the red arrow) in the context of the Adriatic Sea.
Figure 1. (A) Location of the collection of Aurelia pseudosolida sp. nov. in the town of Rovinj (red dot on the left figure). Dark blue lines denote part of the coast visually examined from the shore for Aurelia medusae. In total, 1750 m of shore was examined and 275 individuals of Aurelia solida were found and one individual of Aurelia pseudosolida sp. nov. (B) Location of the town of Rovinj (red dot pointed to by the red arrow) in the context of the Adriatic Sea.
Water 14 00135 g001
Water 14 00135 g002 550
Figure 2. Combined bloom of Aurelia solida and Mnemiopsis leidy.
Figure 2. Combined bloom of Aurelia solida and Mnemiopsis leidy.
Water 14 00135 g002
Water 14 00135 g003 550
Figure 3. Maximum likelihood 16S and ITS1-5.8S phylogenetic trees made using the GTR + G and T92 + G models of evolution, respectively, with four discrete gamma categories, with the position of Aurelia pseudosolida sp. nov. The trees were tested by 1000 bootstrap replicates. Bootstrap support values above 50 are shown next to the respective nodes.
Figure 3. Maximum likelihood 16S and ITS1-5.8S phylogenetic trees made using the GTR + G and T92 + G models of evolution, respectively, with four discrete gamma categories, with the position of Aurelia pseudosolida sp. nov. The trees were tested by 1000 bootstrap replicates. Bootstrap support values above 50 are shown next to the respective nodes.
Water 14 00135 g003
Water 14 00135 g004 550
Figure 4. Aboral (A) and oral (B) side of A. pseudosolida sp. nov. On the right side of the each photograph a cutout in the umbrella can be seen. The tissue in the cutout was used for the DNA extraction.
Figure 4. Aboral (A) and oral (B) side of A. pseudosolida sp. nov. On the right side of the each photograph a cutout in the umbrella can be seen. The tissue in the cutout was used for the DNA extraction.
Water 14 00135 g004
Water 14 00135 g005 550
Figure 5. (A) portion of the bell photographed from the subumbrellar side. The red arrow points to the single origin of the interradial canal. (B) Subgenital pore. (C) Part of an oral arm with brooding chambers. The red arrow points to planulae inside the brooding chamber; (D) Amputated oral arm. (E) Portion of the bell margin with a rhopalium. All bars are 2 mm in length.
Figure 5. (A) portion of the bell photographed from the subumbrellar side. The red arrow points to the single origin of the interradial canal. (B) Subgenital pore. (C) Part of an oral arm with brooding chambers. The red arrow points to planulae inside the brooding chamber; (D) Amputated oral arm. (E) Portion of the bell margin with a rhopalium. All bars are 2 mm in length.
Water 14 00135 g005
Water 14 00135 g006 550
Figure 6. Aurelia pseudosolida sp. nov. (A) Oral side of the sensory organ. (B) Aboral side of the sensory organ. (C) Lateral view of the rhopalium. (D) Gonads with yellow ova. All bars are 500 µm in length.
Figure 6. Aurelia pseudosolida sp. nov. (A) Oral side of the sensory organ. (B) Aboral side of the sensory organ. (C) Lateral view of the rhopalium. (D) Gonads with yellow ova. All bars are 500 µm in length.
Water 14 00135 g006
Water 14 00135 g007 550
Figure 7. (A) Aurelia solida, (isolate ASP1), with the red arrow pointing to the tear-shaped (or pear-shaped) gonads. (B) Aurelia solida with flower-like appearance of the manubrium arms. (C) 1—amputated oral arm of Aurelia pseudosolida sp. nov.; 2—amputated oral arm of Aurelia solida (isolate ASP1). (D) Aboral view of the amputated oral arm of Aurelia solida (isolate ASP1). (E) Manubrium opening of Aurelia solida (isolate ASP1). (F) Detail of the leaf-like structures at the margin of the oral arms of Aurelia solida (isolate ASP1).
Figure 7. (A) Aurelia solida, (isolate ASP1), with the red arrow pointing to the tear-shaped (or pear-shaped) gonads. (B) Aurelia solida with flower-like appearance of the manubrium arms. (C) 1—amputated oral arm of Aurelia pseudosolida sp. nov.; 2—amputated oral arm of Aurelia solida (isolate ASP1). (D) Aboral view of the amputated oral arm of Aurelia solida (isolate ASP1). (E) Manubrium opening of Aurelia solida (isolate ASP1). (F) Detail of the leaf-like structures at the margin of the oral arms of Aurelia solida (isolate ASP1).
Water 14 00135 g007
Table
Table 1. Primers marked with X were used for PCR and/or sequencing (Seq) of 18S-ITS1-5.8S-ITS2-28S region and COI and 16S gene fragments of Aurelia solida and Aurelia pseudosolida sp. nov. individuals.
Table 1. Primers marked with X were used for PCR and/or sequencing (Seq) of 18S-ITS1-5.8S-ITS2-28S region and COI and 16S gene fragments of Aurelia solida and Aurelia pseudosolida sp. nov. individuals.
Primer5′-3′ SequencePCRSeqReference
18S-ITS1-5.8S-ITS2-28S
app2fATCTGGTTGATCCTGCCAGTX Modified from Medlin et al., 1988 [18]
n1800rGATCCTTCCGCAGGTTCACCTX
its5GGAAGTAAAAGTCGTAACAAGGX White et al., 1990 [19]
28srTGGTTCGATTAGTCTTTCGCCX Modified from Ye et al., 2015 [20]
500fATTGGAGGGCAAGTCTGGTGX Universal
1300fGGTGGTGCATGGCCGTTCTTAG X
omm1100rATCCAAGAATTTCACCTCTAACGX This study
oiko800rCTGCTTTGAACACTCTAATTTTTTC X
aur550fGGTAATTCCAGCTCCAATAGC X
aur750fTGTGCTCTTAACTGAGTGTGC X
omm1100rATCCAAGAATTTCACCTCTAACGX
aur58srTTGACATGACGCTCAGACAG X
28sinfACCCGCTGAATTTAAGCATATTAXX
ilitis2rGCATTCCCAAACAACCCGACTCX
aur28s200rTCTCTGATGTGCTGTTCCAAG X
aur28s600rTCTAGGCACGAGTGGATATAAC X
COI
LCO1490GGTCAACAAATCATAAAGATATTGGXXFolmer et al., 1994 [21]
HCO2198TAAACTTCAGGGTGACCAAAAAATCAXX
16S
SHBTCGACTGTTTACCAAAAACATAX Cunningham and Buss (1993) [22]; Schuchert (2005) [23]
SHA2ATTGTAGATAGAAACCTTCCTGX Batistić and Garić, 2016 [24]
Table
Table 2. List of obtained Aurelia sequences in this study.
Table 2. List of obtained Aurelia sequences in this study.
SpeciesIsolateAccession Number
18S-ITS1-
5.8S-ITS2-28S
Aurelia pseudosolida sp. nov.ASP2MZ788652
Aurelia solidaASP6MZ788653
COI
Aurelia pseudosolida sp. nov.ASP2MZ782092
Aurelia solidaASP1MZ782091
Aurelia solidaASP3MZ782093
Aurelia solidaASP4MZ782094
Aurelia solidaASP5MZ782095
Aurelia solidaASP6MZ782096
16S
Aurelia pseudosolida sp. nov.ASP2MZ788655
Aurelia solidaASP1MZ788654
Aurelia solidaASP3MZ788656
Aurelia solidaASP4MZ788657
Aurelia solidaASP5MZ788658
Aurelia solidaASP6MZ788659
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Garić, R.; Batistić, M. Description of Aurelia pseudosolida sp. nov. (Scyphozoa, Ulmaridae) from the Adriatic Sea. Water 2022, 14, 135. https://doi.org/10.3390/w14020135

AMA Style

Garić R, Batistić M. Description of Aurelia pseudosolida sp. nov. (Scyphozoa, Ulmaridae) from the Adriatic Sea. Water. 2022; 14(2):135. https://doi.org/10.3390/w14020135

Chicago/Turabian Style

Garić, Rade, and Mirna Batistić. 2022. "Description of Aurelia pseudosolida sp. nov. (Scyphozoa, Ulmaridae) from the Adriatic Sea" Water 14, no. 2: 135. https://doi.org/10.3390/w14020135

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop