Microrna-130a Downregulates HCV Replication through an atg5-Dependent Autophagy Pathway
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cells and Virus
2.2. MicroRNA Mimics, siRNAs, CRISPR/cas9 gRNAs, Plasmids and Transfection
2.3. RNA Isolation, Rt² Profiler™ Pcr Array and Gene Quantification
2.4. Western Blotting and Antibodies
2.5. Luciferase Reporter Assay
2.6. Statistical Analysis
3. Results
3.1. miR-130a Regulates Host Antiviral Response Genes
3.2. ATG5 Is a Target Gene for miR-130a
3.3. miR-130a Downregulates ATG5 Expression and HCV Replication
3.4. ATG5 Upregulates HCV Replication through Downregulation of ISG Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Liu, X.; Duan, X.; Holmes, J.A.; Li, W.; Lee, S.H.; Tu, Z.; Zhu, C.; Salloum, S.; Lidofsky, A.; Schaefer, E.A.; et al. A novel lncRNA regulates HCV infection through IFI6. Hepatology 2018. [Google Scholar] [CrossRef]
- Li, S.; Duan, X.; Li, Y.; Liu, B.; McGilvray, I.; Chen, L. MicroRNA-130a inhibits HCV replication by restoring the innate immune response. J. Viral Hepat. 2014, 21, 121–128. [Google Scholar] [CrossRef]
- Duan, X.; Li, S.; Holmes, J.A.; Tu, Z.; Li, Y.; Cai, D.; Liu, X.; Li, W.; Yang, C.; Jiao, B.; et al. MicroRNA-130a regulates both HCV and HBV replication through a central metabolic pathway. J. Virol. 2018. [Google Scholar] [CrossRef]
- Lai, X.; Wolkenhauer, O.; Vera, J. Understanding microRNA-mediated gene regulatory networks through mathematical modelling. Nucleic Acids Res. 2016, 44, 6019–6035. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hashimoto, Y.; Akiyama, Y.; Yuasa, Y. Multiple-to-multiple relationships between microRNAs and target genes in gastric cancer. PLoS ONE 2013, 8, e62589. [Google Scholar] [CrossRef]
- Gutierrez, M.G.; Master, S.S.; Singh, S.B.; Taylor, G.A.; Colombo, M.I.; Deretic, V. Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected macrophages. Cell 2004, 119, 753–766. [Google Scholar] [CrossRef] [PubMed]
- Shintani, T.; Klionsky, D.J. Autophagy in health and disease: A double-edged sword. Science 2004, 306, 990–995. [Google Scholar] [CrossRef] [PubMed]
- Levine, B.; Mizushima, N.; Virgin, H.W. Autophagy in immunity and inflammation. Nature 2011, 469, 323–335. [Google Scholar] [CrossRef] [Green Version]
- Sir, D.; Kuo, C.F.; Tian, Y.; Liu, H.M.; Huang, E.J.; Jung, J.U.; Machida, K.; Ou, J.H. Replication of hepatitis C virus RNA on autophagosomal membranes. J. Biol. Chem. 2012, 287, 18036–18043. [Google Scholar] [CrossRef] [PubMed]
- Subramanian, G.; Kuzmanovic, T.; Zhang, Y.; Peter, C.B.; Veleeparambil, M.; Chakravarti, R.; Sen, G.C.; Chattopadhyay, S. A new mechanism of interferon’s antiviral action: Induction of autophagy, essential for paramyxovirus replication, is inhibited by the interferon stimulated gene, TDRD7. PLoS Pathog. 2018, 14, e1006877. [Google Scholar] [CrossRef]
- Pratt, Z.L.; Sugden, B. How human tumor viruses make use of autophagy. Cells 2012, 1, 617–630. [Google Scholar] [CrossRef] [PubMed]
- Petruzziello, A.; Marigliano, S.; Loquercio, G.; Cozzolino, A.; Cacciapuoti, C. Global epidemiology of hepatitis C virus infection: an up-date of the distribution and circulation of hepatitis C virus genotypes. World J. Gastroenterol. 2016, 22, 7824. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.; Choe, W.H.; Hiasa, Y.; Kamegaya, Y.; Blackard, J.T.; Schmidt, E.V.; Chung, R.T. Hepatitis C virus expression suppresses interferon signaling by degrading STAT1. Gastroenterology 2005, 128, 1034–1041. [Google Scholar] [PubMed]
- Lin, W.; Tsai, W.L.; Shao, R.X.; Wu, G.; Peng, L.F.; Barlow, L.L.; Chung, W.J.; Zhang, L.; Zhao, H.; Jang, J.Y.; et al. Hepatitis C virus regulates transforming growth factor beta1 production through the generation of reactive oxygen species in a nuclear factor kappaB-dependent manner. Gastroenterology 2010, 138, 2509–2518, 2518 e2501. [Google Scholar] [CrossRef] [PubMed]
- Lin, W.; Kim, S.S.; Yeung, E.; Kamegaya, Y.; Blackard, J.T.; Kim, K.A.; Holtzman, M.J.; Chung, R.T. Hepatitis C virus core protein blocks interferon signaling by interaction with the STAT1 SH2 domain. J. Virol. 2006, 80, 9226–9235. [Google Scholar] [CrossRef] [PubMed]
- Zhu, C.; Xiao, F.; Hong, J.; Wang, K.; Liu, X.; Cai, D.; Fusco, D.N.; Zhao, L.; Jeong, S.W.; Brisac, C.; et al. EFTUD2 Is a Novel Innate Immune Regulator Restricting Hepatitis C Virus Infection through the RIG-I/MDA5 Pathway. J. Virol. 2015, 89, 6608–6618. [Google Scholar] [CrossRef] [Green Version]
- Lin, W.; Zhu, C.; Hong, J.; Zhao, L.; Jilg, N.; Fusco, D.N.; Schaefer, E.A.; Brisac, C.; Liu, X.; Peng, L.F.; et al. The spliceosome factor SART1 exerts its anti-HCV action through mRNA splicing. J. Hepatol. 2015, 62, 1024–1032. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Tian, Y.; Ou, J.H. HCV induces the expression of Rubicon and UVRAG to temporally regulate the maturation of autophagosomes and viral replication. PLoS Pathog. 2015, 11, e1004764. [Google Scholar] [CrossRef] [PubMed]
- Dreux, M.; Gastaminza, P.; Wieland, S.F.; Chisari, F.V. The autophagy machinery is required to initiate hepatitis C virus replication. Proc. Natl. Acad. Sci. USA 2009, 106, 14046–14051. [Google Scholar] [CrossRef] [Green Version]
- Ferraris, P.; Blanchard, E.; Roingeard, P. Ultrastructural and biochemical analyses of hepatitis C virus-associated host cell membranes. J. Gen. Virol. 2010, 91, 2230–2237. [Google Scholar] [CrossRef] [Green Version]
- Fahmy, A.M.; Labonte, P. The autophagy elongation complex (ATG5-12/16L1) positively regulates HCV replication and is required for wild-type membranous web formation. Sci. Rep. 2017, 7, 40351. [Google Scholar] [CrossRef] [Green Version]
- Shrivastava, S.; Devhare, P.; Sujijantarat, N.; Steele, R.; Kwon, Y.C.; Ray, R.; Ray, R.B. Knockdown of Autophagy Inhibits Infectious Hepatitis C Virus Release by the Exosomal Pathway. J. Virol. 2016, 90, 1387–1396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tanida, I.; Fukasawa, M.; Ueno, T.; Kominami, E.; Wakita, T.; Hanada, K. Knockdown of autophagy-related gene decreases the production of infectious hepatitis C virus particles. Autophagy 2009, 5, 937–945. [Google Scholar] [CrossRef] [PubMed]
- Jounai, N.; Takeshita, F.; Kobiyama, K.; Sawano, A.; Miyawaki, A.; Xin, K.Q.; Ishii, K.J.; Kawai, T.; Akira, S.; Suzuki, K.; et al. The Atg5 Atg12 conjugate associates with innate antiviral immune responses. Proc. Natl. Acad. Sci. USA 2007, 104, 14050–14055. [Google Scholar] [CrossRef] [PubMed]
- Lee, H.K.; Lund, J.M.; Ramanathan, B.; Mizushima, N.; Iwasaki, A. Autophagy-dependent viral recognition by plasmacytoid dendritic cells. Science 2007, 315, 1398–1401. [Google Scholar] [CrossRef] [PubMed]
- Shrivastava, S.; Raychoudhuri, A.; Steele, R.; Ray, R.; Ray, R.B. Knockdown of autophagy enhances the innate immune response in hepatitis C virus-infected hepatocytes. Hepatology 2011, 53, 406–414. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Meng, S.; Liu, B.; Li, M.Q.; Li, Y.; Fang, L.; Li, Y.G. MicroRNA-130a regulates autophagy of endothelial progenitor cells through Runx3. Clin. Exp. Pharmacol. Physiol. 2014, 41, 351–357. [Google Scholar] [CrossRef] [PubMed]
- Kovaleva, V.; Mora, R.; Park, Y.J.; Plass, C.; Chiramel, A.I.; Bartenschlager, R.; Dohner, H.; Stilgenbauer, S.; Pscherer, A.; Lichter, P.; et al. miRNA-130a targets ATG2B and DICER1 to inhibit autophagy and trigger killing of chronic lymphocytic leukemia cells. Cancer Res. 2012, 72, 1763–1772. [Google Scholar] [CrossRef]
- Matsushita, M.; Suzuki, N.N.; Obara, K.; Fujioka, Y.; Ohsumi, Y.; Inagaki, F. Structure of Atg5.Atg16, a complex essential for autophagy. J. Biol. Chem. 2007, 282, 6763–6772. [Google Scholar] [CrossRef] [PubMed]
- Trobaugh, D.W.; Klimstra, W.B. MicroRNA Regulation of RNA Virus Replication and Pathogenesis. Trends Mol. Med. 2017, 23, 80–93. [Google Scholar] [CrossRef] [PubMed]
- Flynt, A.S.; Lai, E.C. Biological principles of microRNA-mediated regulation: shared themes amid diversity. Nat. Rev. Genet. 2008, 9, 831–842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vidigal, J.A.; Ventura, A. The biological functions of miRNAs: lessons from in vivo studies. Trends Cell Biol. 2015, 25, 137–147. [Google Scholar] [CrossRef] [PubMed]
- Barathan, M.; Mohamed, R.; Yong, Y.K.; Kannan, M.; Vadivelu, J.; Saeidi, A.; Larsson, M.; Shankar, E.M. Viral Persistence and Chronicity in Hepatitis C Virus Infection: Role of T-Cell Apoptosis, Senescence and Exhaustion. Cells 2018, 7, 165. [Google Scholar] [CrossRef] [PubMed]
- Guevin, C.; Manna, D.; Belanger, C.; Konan, K.V.; Mak, P.; Labonte, P. Autophagy protein ATG5 interacts transiently with the hepatitis C virus RNA polymerase (NS5B) early during infection. Virology 2010, 405, 1–7. [Google Scholar] [CrossRef] [Green Version]
- Perot, B.P.; Boussier, J.; Yatim, N.; Rossman, J.S.; Ingersoll, M.A.; Albert, M.L. Autophagy diminishes the early interferon-beta response to influenza A virus resulting in differential expression of interferon-stimulated genes. Cell Death Dis. 2018, 9, 539. [Google Scholar] [CrossRef]






| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| ATG5 | TGTGCTTCGAGATGTGTGGTT | ACCAACGTCAAATAGCTGACTC |
| CASP1 | CAGCCCTGGTGTGGTGTG | AAAATCCTTCTCTATGTGGGCTTTC |
| CD80 | CACCTGGCTGAAGTGAC | GTCAGGCAGCATATCAC |
| IL18 | CTTCCAGATCGCTTCCTCTC | TCAAATAGAGGCCGATTTCC |
| DHX58 | GGGCCTCCAAACTCGATGG | TTCTGGGGTGACATGATGCAC |
| MX1 | GTTTCCGAAGTGGACATCGCA | GAAGGGCAACTCCTGACAGT |
| OAS3 | GAAGGAGTTCGTAGAGAAGGCG | CCCTTGACAGTTTTCAGCACC |
| PYCARD | TGGTCAGCTTCTACCTGGAG | CAGCCACTCAACGTTTGTGA |
| CD86 | GGGCCGCACAAGTTTTGA | GCCCTTGTCCTTGATCTGAA |
| IL6 | GACAACTTTGGCATTGTGG | ATGCAGGGATGATGTTCTG |
| TLR7 | TCCTTGGGGCTAGATGGTTTC | TCCACGATCACATGGTTCTTTG |
| JFH1 | TCTGCGGAACCGGTGAGTA | TCAGGCAGTACCACAAGGC |
| GAPDH | ACCTTCCCCATGGTGTCTGA | GCTCCTCCTGTTCGACAGTCA |
| Gene Name | Relative Expression * | Gene Name | Relative Expression |
|---|---|---|---|
| DHX58 | 4.27 | MYD88 | 1.65 |
| PYCARD | 3.44 | ISG15 | 1.63 |
| TLR7 | 2.99 | RELA | 1.63 |
| MX1 | 2.67 | DDX58 | 1.62 |
| CD86 | 2.38 | TRADD | 1.61 |
| IL6 | 2.3 | MAPK3 | 1.6 |
| PYDC1 | 1.95 | CASP10 | 1.58 |
| MAPK14 | 1.95 | CTSS | 1.58 |
| MAP3K1 | 1.95 | MAPK1 | 1.56 |
| IRAK1 | 1.95 | TBK1 | 1.55 |
| SPP1 | 1.9 | IRF5 | 1.54 |
| FADD | 1.85 | TLR9 | 1.53 |
| JUN | 1.83 | IL18 | 0.54 |
| NFKBIA | 1.77 | ATG5 | 0.55 |
| CXCL11 | 1.69 | CD80 | 0.65 |
| IKBKB | 1.66 | CASP1 | 0.67 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duan, X.; Liu, X.; Li, W.; Holmes, J.A.; Kruger, A.J.; Yang, C.; Li, Y.; Xu, M.; Ye, H.; Li, S.; et al. Microrna-130a Downregulates HCV Replication through an atg5-Dependent Autophagy Pathway. Cells 2019, 8, 338. https://doi.org/10.3390/cells8040338
Duan X, Liu X, Li W, Holmes JA, Kruger AJ, Yang C, Li Y, Xu M, Ye H, Li S, et al. Microrna-130a Downregulates HCV Replication through an atg5-Dependent Autophagy Pathway. Cells. 2019; 8(4):338. https://doi.org/10.3390/cells8040338
Chicago/Turabian StyleDuan, Xiaoqiong, Xiao Liu, Wenting Li, Jacinta A. Holmes, Annie J. Kruger, Chunhui Yang, Yujia Li, Min Xu, Haiyan Ye, Shuang Li, and et al. 2019. "Microrna-130a Downregulates HCV Replication through an atg5-Dependent Autophagy Pathway" Cells 8, no. 4: 338. https://doi.org/10.3390/cells8040338

