Rapid Identification of Tropical Important Mealybugs Based on a Multiplex PCR Assay
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of Mealybugs
2.2. Non-Destructive DNA Extraction
2.3. PCR Amplification and Sequencing
2.4. Construction and Optimization of the mPCR Assay
3. Results
3.1. Amplification and Analysis of the COI Gene
3.2. Assay for Identifying Three Mealybug Species
3.3. Assay Specificity and Sensitivity
3.4. Field Sample Tests
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Williams, D.J.; Granara de Willink, M.C. Mealybugs of Central and South America; CABI Publishing: Wallingford, UK, 1992; p. 635. [Google Scholar]
- Zhang, H.; Zhao, X.; Cao, X.; Khan, L.U.; Zhao, R.; Wang, H.; Huang, X. Transmission of areca palm velarivirus 1 by mealybugs causes yellow leaf disease in betel palm (Areca catechu). Phytopathology 2022, 112, 700–707. [Google Scholar] [CrossRef] [PubMed]
- Dey, K.K.; Green, J.C.; Melzer, M.; Borth, W.; Hu, J.S. Mealybug wilt of pineapple and associated viruses. Horticulturae 2018, 4, 52. [Google Scholar] [CrossRef]
- Pacheco da Silva, V.C.; Bertin, A.; Blin, A.; Germain, J.-F.; Bernardi, D.; Rignol, G.; Botton, M.; Malausa, T. Molecular and morphological identification of mealybug species (Hemiptera: Pseudococcidae) in Brazilian vineyards. PLoS ONE 2014, 9, e103267. [Google Scholar] [CrossRef] [PubMed]
- Qin, Z.; Wu, J.; Ren, S.; Wan, F. Risk analysis of the alien invasive gray pineapple mealybug (Dysmicoccus neobrevipes Beardsley) in China. Sci. Agric. Sin. 2010, 43, 626–631. [Google Scholar]
- Xu, W.; Fu, H.; Long, Q.; Jiang, L.; Zhao, G.; Zou, X.; Han, Y. Pest found in Hainan Province—Phenacoccus solenopsis Tinsley. Plant Quar. 2009, 23, 33. [Google Scholar]
- Lu, N.; Cai, B.; Ma, X.; Xu, M.; Long, Y.; Meng, R.; Wu, F.; Lin, W.; Xu, W.; Yuan, J.; et al. Beware of dispersal of a quarantine pest insect, Planococcus minor (Maskell, 1897), in Chinese Mainland. Plant Quar. 2021, 35, 65–69. [Google Scholar]
- Krishnan, J.U.; George, M.; Ajesh, G.; Jithine, J.; Lekshmi, N.; Deepasree, M. A review on Paracoccus marginatus Williams, papaya mealybug (Hemiptera: Pseudococcidae). J. Entomol. Zool. Stud. 2016, 4, 528–533. [Google Scholar]
- Cai, B.; Ao, S.; Meng, R.; Xu, M.; Wei, J.; Yang, M. A survey of main mealybug species and their infestations in Hainan. J. Trop. Biol. 2023, 14, 82–87. [Google Scholar]
- Cai, B.; Zhao, C.; Li, F.; Chen, S.; Jia, J.; Liu, F.; Wu, S. Application of DNA barcoding in rapid identification of Contarinia maculipennis Felt infesting Dendrobium nobile. J. Trop. Biol. 2024, 15, 493–498. [Google Scholar]
- Comtet, T.; Sandionigi, A.; Viard, F.; Casiraghi, M. DNA (meta) barcoding of biological invasions: A powerful tool to elucidate invasion processes and help managing aliens. Biol. Invasions 2015, 17, 905–922. [Google Scholar] [CrossRef]
- Cai, B.; Wen, S.; Zhan, K.; Pei, J.; Wan, P.; Liu, F.; Wu, S. Identification of Pissodes castaneus (DeGeer), a quarantine pest. J. Trop. Biol. 2024, 15, 332–336. [Google Scholar]
- Hebert, P.D.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [PubMed]
- Salis, R.; Sunde, J.; Gubonin, N.; Franzén, M.; Forsman, A. Performance of DNA metabarcoding, standard barcoding and morphological approaches in the identification of insect biodiversity. Mol. Ecol. Resour. 2024, 8, e14018. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Z.; Li, Q.; Deng, J.; Liu, Q.; Huang, X. The devil is in the details: Problems in DNA barcoding practices indicated by systematic evaluation of insect barcodes. Front. Ecol. Evol. 2023, 11, 1149839. [Google Scholar] [CrossRef]
- Park, S.R.; Lee, D.E.; Nam, H.Y.; Kim, J.; Lee, S.H.; Kim, J.H. Development of Multiplex PCR-based Protocols for Simultaneous Caterpillar Diagnosis of Three Spodoptera and One Mamestra Species (Lepidoptera: Noctuidae). J. Econ. Entomol. 2022, 115, 1703–1711. [Google Scholar] [CrossRef]
- Sun, Y.; Chen, G.; Zhang, C.; Guo, C.; Wang, Y.; Sun, R. Development of a multiplex polymerase chain reaction assay for the parallel detection of harmful algal bloom-forming species distributed along the Chinese coast. Harmful Algae 2019, 84, 36–45. [Google Scholar] [CrossRef]
- Ye, Z.; Vollhardt, I.M.; Girtler, S.; Wallinger, C.; Tomanovic, Z.; Traugott, M. An effective molecular approach for assessing cereal aphid-parasitoid-endosymbiont networks. Sci. Rep. 2017, 7, 3138. [Google Scholar] [CrossRef]
- Pava-Ripoll, M.; Miller, A.K.; Ziobro, G.C. Development of a Multiplex Polymerase Chain Reaction (PCR) Assay for the Potential Detection of Insect Contaminants in Food. J. Food Prot. 2023, 86, 100120. [Google Scholar] [CrossRef]
- Taniuchi, M.; Walters, C.C.; Gratz, J.; Maro, A.; Kumburu, H.; Serichantalergs, O.; Sethabutr, O.; Bodhidatta, L.; Kibiki, G.; Toney, D.M. Development of a multiplex polymerase chain reaction assay for diarrheagenic Escherichia coli and Shigella spp. and its evaluation on colonies, culture broths, and stool. Diagn. Microbiol. Infect. Dis. 2012, 73, 121–128. [Google Scholar] [CrossRef]
- Park, D.S.; Leem, Y.J.; Hahn, K.W.; Suh, S.J.; Hong, K.J.; Oh, H.W. Molecular Identification of Mealybugs (Hemiptera: Pseudococcidae) Found on Korean Pears. J. Econ. Entomol. 2010, 103, 25–33. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Wan, X.; Liu, Y.; Sun, G.; Zhan, R. Mitochondrial COI from Dysmicoccus brevipes (Hemiptera: Pseudococcidae) suggests cryptic lineage and pinpoints the source of the introduction to China. Fla. Entomol. 2012, 95, 183–191. [Google Scholar] [CrossRef]
- Kvist, S. Barcoding in the dark? A critical view of the sufficiency of zoological DNA barcoding databases and a plea for broader integration of taxonomic knowledge. Mol. Phylogenetics Evol. 2013, 69, 39–45. [Google Scholar] [CrossRef] [PubMed]
- Ye, Z.; Vollhardt, I.M.; Tomanovic, Z.; Traugott, M. Evaluation of three molecular markers for identification of European primary parasitoids of cereal aphids and their hyperparasitoids. PLoS ONE 2017, 12, e0177376. [Google Scholar] [CrossRef]
- Luo, A.; Lan, H.; Ling, C.; Zhang, A.; Shi, L.; Ho, S.Y.; Zhu, C. A simulation study of sample size for DNA barcoding. Ecol. Evol. 2015, 5, 5869–5879. [Google Scholar] [CrossRef]
- Huemer, P.; Mutanen, M.; Sefc, K.M.; Hebert, P.D. Testing DNA barcode performance in 1000 species of European Lepidoptera: Large geographic distances have small genetic impacts. PLoS ONE 2014, 9, e115774. [Google Scholar] [CrossRef]
- Zhan, A. Rapid Identification Techniques for Important Invasive Mealybug Species and Their Close Relatives. Master’s Thesis, Zhejiang University, Hangzhou, China, 2021. [Google Scholar]
- Estoup, A.; Garnery, L.; Solignac, M.; Cornuet, J.-M. Microsatellite variation in honey bee (Apis mellifera L.) populations: Hierarchical genetic structure and test of the infinite allele and stepwise mutation models. Genetics 1995, 140, 679–695. [Google Scholar] [CrossRef]
- Aguirre, C.; Sánchez, E.; Olivares, N.; Hinrichsen, P. Multiplex TaqMan real-time PCR assay for sensitive detection of two weevil species (Coleoptera: Curculionidae). J. Econ. Entomol. 2021, 114, 90–99. [Google Scholar] [CrossRef]
- Gariepy, T.D.; Kuhlmann, U.; Gillott, C.; Erlandson, M. Parasitoids, predators and PCR: The use of diagnostic molecular markers in biological control of Arthropods. J. Appl. Entomol. 2007, 131, 225–240. [Google Scholar] [CrossRef]
- Blaser, S.; Diem, H.; von Felten, A.; Gueuning, M.; Andreou, M.; Boonham, N.; Tomlinson, J.; Müller, P.; Utzinger, J.; Frey, J.E.; et al. From laboratory to point of entry: Development and implementation of a loop-mediated isothermal amplification (LAMP)-based genetic identification system to prevent introduction of quarantine insect species. Pest Manag. Sci. 2018, 74, 1504–1512. [Google Scholar] [CrossRef]
- Chen, Y.; Shi, M.; Chen, Y.; Zhao, J.; Yang, X.; Fu, J.; Desneux, N.; Li, J. Rapid and equipment-free identification of papaya mealybug Paracoccus marginatus based on RPA-CRISPR/Cas12a. Pest Manag. Sci. 2024. [Google Scholar] [CrossRef] [PubMed]
- Haviland, D.R.; Bentley, W.J.; Daane, K.M. Hot-water treatments for control of Planococcus ficus (Homoptera: Pseudococcidae) on dormant grape cuttings. J. Econ. Entomol. 2005, 98, 1109–1115. [Google Scholar] [CrossRef] [PubMed]
- Thomsen, P.F.; Kielgast, J.; Iversen, L.L.; Wiuf, C.; Rasmussen, M.; Gilbert, M.T.P.; Orlando, L.; Willerslev, E. Monitoring endangered freshwater biodiversity using environmental DNA. Mol. Ecol. 2012, 21, 2565–2573. [Google Scholar] [CrossRef] [PubMed]
Genus | Species | Number of COI Sequences | GenBank Accession No. |
---|---|---|---|
Dysmicoccus | Dysmicoccus neobrevipes | 3 | PQ558664, PQ568066, PQ568067 |
Maconellicoccus | Maconellicoccus hirsutus | 3 | PQ567098–PQ567100 |
Paracoccus | Paracoccus marginatus | 5 | PQ567076–PQ567080 |
Phenacoccus | Phenacoccus madeirensis | 3 | PQ567106–PQ567108 |
Phenacoccus solenopsis | 3 | PQ568059–PQ568061 | |
Phenacoccus solani | 3 | PQ568071–PQ568073 | |
Planococcus | Planococcus minor | 4 | PQ568023–PQ568026 |
Planococcus citri | 3 | PQ569629–PQ569631 | |
Ferrisia | Ferrisia virgata | 3 | PQ568063–PQ568065 |
Pseudococcus | Pseudococcus jackbeardsleyi | 3 | PQ568007–PQ568009 |
Pseudococcus cryptus | 3 | PQ569954–PQ569956 | |
Nipaecoccus | Nipaecoccus viridis | 3 | PQ567102–PQ567104 |
Species | Primer Name and Sequence (5′–3′) | Length (bp) | Amplicon (bp) |
---|---|---|---|
Dysmicoccus neobrevipes | Dn-F: TTTTTTATAACAATACCTATTATTATTGGTAGT | 33 | 397 |
Dn-R: AATAGGAATTGAAATAATTAATAGAAATGTT | 31 | ||
Maconellicoccus hirsutus | Mh-F: TATTATATAATAATTACTTTACATGCCTTTTTA | 33 | 260 |
Mh-R: GTGTAATATAATTTTGATTAATTAGGGGT | 29 | ||
Paracoccus marginatus | Pm-F: GATTTTGATTATTAATTCCATCTTTAATT | 29 | 166 |
Pm-R: AAATTGAAGATAAACCATTTAAATGTAAT | 29 |
Methods | Species | Number of Samples (n = 121) | Percentage (%) |
---|---|---|---|
Multiplex PCR | Dysmicoccus neobrevipes | 11 | 9.09 |
Maconellicoccus hirsutus | 5 | 4.13 | |
Paracoccus marginatus | 32 | 26.45 | |
Sangerse quencing | Ferrisia virgata | 11 | 9.09 |
Nipaecoccus viridis | 3 | 2.48 | |
Phenacoccus madeirensis | 5 | 4.13 | |
Phenacoccus solani | 5 | 4.13 | |
Phenacoccus solenopsis | 7 | 5.79 | |
Planococcus citri | 6 | 4.96 | |
Planococcus minor | 14 | 11.57 | |
Pseudococcus cryptus | 10 | 8.26 | |
Pseudococcus jackbeardsleyi | 8 | 6.61 | |
Icerya seychellarum | 1 | 0.83 | |
Pseudococcidae sp. | 3 | 2.48 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xi, Y.; Yan, W.; Liu, K.; Cai, B.; Wu, S. Rapid Identification of Tropical Important Mealybugs Based on a Multiplex PCR Assay. Agronomy 2024, 14, 2786. https://doi.org/10.3390/agronomy14122786
Xi Y, Yan W, Liu K, Cai B, Wu S. Rapid Identification of Tropical Important Mealybugs Based on a Multiplex PCR Assay. Agronomy. 2024; 14(12):2786. https://doi.org/10.3390/agronomy14122786
Chicago/Turabian StyleXi, Yu, Wenqian Yan, Kaiyang Liu, Bo Cai, and Shaoying Wu. 2024. "Rapid Identification of Tropical Important Mealybugs Based on a Multiplex PCR Assay" Agronomy 14, no. 12: 2786. https://doi.org/10.3390/agronomy14122786
APA StyleXi, Y., Yan, W., Liu, K., Cai, B., & Wu, S. (2024). Rapid Identification of Tropical Important Mealybugs Based on a Multiplex PCR Assay. Agronomy, 14(12), 2786. https://doi.org/10.3390/agronomy14122786