Next Article in Journal
Evaluation of the Effect of ‘Candidatus Liberibacter Solanacearum’ Haplotypes in Tobacco Infection
Next Article in Special Issue
Effect of Salt Stress on Microbiome Structure and Diversity in Chamomile (Matricaria chamomilla L.) Rhizosphere Soil
Previous Article in Journal
Synthesis of Aminophenoxazinones and Evaluation of Their Phytotoxicity in the Search for New Natural Herbicides
Previous Article in Special Issue
Plant-Growth-Promoting Rhizobacteria Improve Germination and Bioactive Compounds in Cucumber Seedlings
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation

1
National Engineering Research Center for Efficient Utilization of Soil and Fertilizer Resources, College of Resources and Environment, Shandong Agricultural University, Taian 271018, China
2
Department of Molecular Biology, University of Wyoming, Laramie, WY 82071, USA
3
Key Laboratory of Coastal Environmental Processes and Ecological Remediation, Yantai Institute of Coastal Zone Research, Chinese Academy of Sciences, Yantai 264003, China
4
Shandong Tunqi Biotechnology Co., Ltd., Jinin 272507, China
*
Author to whom correspondence should be addressed.
Agronomy 2023, 13(2), 570; https://doi.org/10.3390/agronomy13020570
Submission received: 23 January 2023 / Revised: 8 February 2023 / Accepted: 8 February 2023 / Published: 16 February 2023
(This article belongs to the Special Issue Rhizosphere Microorganisms)

Abstract

:
Ensifer alkalisoli YIC4027T is a dominant rhizobium that has been isolated from the root nodules of Sesbania cannabina. Motility and chemotaxis are critical to maintaining competitiveness in establishing the symbiotic relationship. E. alkalisoli carries two gene clusters, che1 and che2, containing chemotaxis-related gene homologues. To determine the respective role of each gene cluster, we constructed mutants and compared them with the wild type in a free-living state and in symbiosis with the host plant. A swimming analysis revealed that the che1 cluster was the major pathway controlling the chemotaxis and swimming bias, while the che2 cluster had a minor role in these behaviors. However, the Δche2 mutant was impaired in exopolysaccharide (EPS) production. During symbiosis, the Δche1 mutant was more severely impaired in its competitive root colonization and nodulation ability than the Δche2 mutant. Taken together, our data strongly suggested that both of the che clusters contribute to the competitive symbiotic association, the che1-like homologue being the main regulator of the chemotactic response and the che2 cluster regulating EPS production. These data illustrated a novel strategy of motile rhizobia bacteria to utilize the two pathways containing the homologous genes to enhance the efficiency of nodule formation by regulating distinct motility parameters or other cellular functions.

1. Introduction

The symbiotic association between rhizobia and legumes is of importance in sustainable agriculture since, within root nodules, rhizobia convert atmospheric dinitrogen (N2) gas into ammonia, resulting in increased plant growth and productivity [1,2]. The pioneer legume Sesbania cannabina is widely cultivated for land reclamation in the area of the Yellow River Delta (Shandong Province in China) due to its outstanding resistance to salt and flooding stress [3,4]. An analysis of the rhizobia from S. cannabina root nodules led to the identification of several species of the Ensifer genus, which is dominant in the local isolates [5]. Among these, a novel group of Ensifer sp. was identified as belonging to a new species, named Ensifer alkalisoli, due to its high tolerance to saline–alkaline growth conditions, with YIC4027T as the type strain [6]. The strain shows high symbiotic efficiency and a narrow host range that is limited to S. cannabina [7]. To better understand the molecular basis of its symbiotic association with its host plant, the nucleotide sequence of the complete genome of E. alkalisoli YIC4027T was determined and was fully annotated [7]. Of particular interest were the genes encoding chemotaxis since it is well established that chemotaxis is crucial for nodulation competitiveness in the host plants [8,9].
Chemotaxis, which was studied in detail in Esherichia coli, confers in bacteria the ability to move towards attractants or away from repellents [10,11]. The chemotaxis system in E. coli contains Che proteins, which are encoded by seven different genes in a single che cluster, and chemoreceptors, which are also called methyl-accepting chemotaxis proteins (MCPs) [12]. In brief, chemoreceptors, upon sensing environmental signals, regulate the phosphorylated state of CheA via binding to CheW. Then, the phosphoryl group is transferred from the autophosphorylated CheA to the response regulator CheY. Phospho-CheY then interacts with the flagellar motors to control cell swimming [13,14]. The process is modulated by other Che proteins (CheC, X, D, V, and E) [15,16,17,18] in some motile chemotactic bacteria that may carry multiple chemotactic systems [19,20,21]. The majority of chemosensory pathways control flagellar motility (Fla) [22,23,24]; however, some are associated with type IV pilus-based motility (TFP) or alternative cellular functions (ACFs) [19,25], such as cell differentiation [26], cell–cell interactions [27,28], and biofilm formation [29,30,31].
Ensifer alkalisoli YIC4027T is a motile Alphaproteobacterium that contains two chemotaxis (che) gene clusters, named che1 and che2, and thirteen putative chemoreceptor genes [7]. The che1 cluster (EKH55_0219 to EKH55_0228) encodes MCP, CheS, CheY1, CheY2, CheA1, CheW, CheR, CheB, CheD, and CheT and is present on the chromosome [7]. The che2 cluster (EKH55_5525 to EKH55_5529), which is located on the chromid, contains the genes encoding the CheR, CheW, MCP, CheA2-REC, and CheB proteins [7]. In a previous study, we showed that the gene encoding the histidine kinase in the che1 cluster, cheA1, plays a role in chemotaxis and the symbiotic association between YIC4027T and S. cannabina, while that in cluster che2, cheA2, was dispensable in this regard [7]. Given the crucial role of the chemotaxis system in bacterial recognition and competitive nodulation [32,33], it is important to determine the respective role of each chemotaxis cluster.
In the present work, we constructed deletion mutant strains covering each che gene cluster, che1 and che2, to investigate the contribution of each cluster to the chemotaxis response of E. alkalisoli YIC4027T and to investigate their effect on symbiotic nodulation. Our results showed that the che1 cluster was essential for chemotaxis motility and that it directly modulated the probability of swimming reversals, providing a competitive advantage for root colonization and nodulation in E. alkalisoli YIC4027T. The che2 cluster had a minor role in chemotaxis and swimming motility; however, the deletion of the che2 cluster resulted in impaired EPS production and competitive root colonization and nodulation. Together, these data documented how motile bacteria can utilize two chemotaxis pathways to regulate their chemotactic motility pattern and competitive nodulation.

2. Results

2.1. Comparative Organization of the Chemotaxis Clusters in E. alkalisoli YIC4027T and Other Alphaproteobacteria

The presence of two chemotaxis gene clusters, named che1 and che2, in the genome of E. alkalisoli YIC4027T was previously reported [7]. Based on the phylogenomic classification [19], che1 belongs to the F7 system of the Fla class, while che2 belongs to the ACF class of unknown function. In an attempt to predict the function of the two clusters by comparing them with phylogenetically close microorganisms, we constructed a phylogenetic tree by using the 16S rRNA locus (Figure 1B). From this comparison, it appeared that the che1 cluster was extremely conserved and that it shared a common gene order with the chemotaxis cluster controlling flagellar motility in E. meliloti, Rhizobium leguminosarum bv. viciae, and Agrobacterium tumefaciens [34,35,36] as well as Rhizobium etli [37]. Indeed, the che1 cluster contained a complete set of genes coding for the chemotaxis proteins known to be in E. coli [38], except cheZ, and included components that were not seen in E. coli, such as the deamidase CheD and the auxiliary protein CheS. The cheT gene (orf EKH55_0228), located downstream of cheD (Figure 1A,B), was not present in enteric bacteria [8]. Moreover, this set of conserved genes was chromosomally located in all these strains. In addition, the flagellar-motility-related genes (EKH55_0229 to EKH55_0274) (Figure 1A) were located downstream of the che1 cluster, suggesting that che1 also controlled flagellar motility. In other strains which were less phylogenetically close to E. alkalisoli, the genes were conserved, but the organization differed.
The che2 cluster had a gene order that was identical to that of the corresponding orthologous cluster in phylogenetically closely related E. meliloti [8,40]. Although a che2 orthologue was present in E. meliloti, it had weak expression during liquid culture growth, and its function remains to be determined [8,41]. Cluster 2 (EKH55_5525 to EKH55_5529) contained another copy of mcp, cheR, cheW, and cheB as well as cheA2-REC but did not contain cheY, the cheY2 gene being located in cluster 1. The absence of a cheY gene indicated that the che2 cluster did not control flagella-mediated motility. The genes related to the Flp pilus assembly (EKH55_5530 to EKH55_5538) were located downstream of the che2 cluster, suggesting that the che2 cluster may regulate type IV pilus-mediated motility.
The genes encoding the phosphatases that monitor the dephosphorylation of CheY-P [15], such as the cheZ gene, were not present in Alphaproteobacteria, except for in A. caulinodans, where cheZ was adjacent to a cheY gene outside of the main chemotaxis cluster [42]. Other genes encoding phosphatases, such as cheC, which was found in one of the four clusters of A. brasilense [24,43], were not present in E. alkalisoli. As phosphorylated CheY1 autodephosphorylates constantly in E. meliloti, we can assume that CheY1 might emulate the role of phosphatases in E. alkalisoli YIC4027T. A total of thirteen genes encoding chemoreceptor proteins were annotated in the genome of the YIC4027T strain, two of them being associated with the che clusters [7]. The presence of this large number of chemoreceptor genes suggested that YIC4027T may sense a variety of chemoattractants or repellents.

2.2. Both the E. alkalisoli YIC4027T Chemotaxis Clusters were Involved in the Chemotactic Response toward Different Carbon Sources

To characterize the contribution of the che clusters to the chemotactic response in YIC4027T, we constructed strains with in-frame deletions of each che cluster from mcp to cheD for the che1 cluster and from cheR to cheB for the che2 cluster as depicted in Figure 1A. The chemotaxis behavior of the resulting strains, Δche1 and Δche2, was compared to that of the wild type and the ΔcheA1 and ΔcheA2 mutant strains that were previously constructed [7]. The data were quantified by measuring the chemotaxis diameter rings on soft agar plates containing L3 medium supplemented with various carbon sources. The deletion of the che1 cluster or the cheA1 gene resulted in a complete loss of the chemotactic response regardless of the presence or absence of combined nitrogen, while the deletion of the che2 cluster exhibited an approximately 27% reduction in the chemotaxis ring diameter (Figure 2). However, as reported earlier, the deletion of cheA2 had no effect on the chemotaxis behavior (Figure 2) [7], suggesting that another gene in the che2 cluster was involved in the chemotactic response. Both the che cluster deletion mutant strains displayed the same growth rate in TY broth medium or L3 minimal medium (Supplementary Figure S1), ruling out that differences in the chemotactic response were related to growth.

2.3. The che1 Cluster was Mainly Involved in the Control of the Swimming Motility Behavior

Chemotaxis ultimately controls the cell swimming motility patterns by affecting the direction of flagellar rotation [10,13,44]. To further investigate the involvement of these two clusters in swimming motility, we compared the swimming behavior of the YIC4027T wild type and the mutant strains (Figure 3). The wild-type strain showed long runs of swimming interrupted by sudden direction changes (reversals) with an average probability of about 1.14 reversals per second (Supplementary Movie S1). In contrast to the wild type, the Δche1 and ΔcheA1 mutant strains swam in nearly straight lines or constantly ran without reversal (Supplementary Movies S2,3). The Δche2 (0.776 reversal/s) mutant displayed a frequency of reversals that was lower than that of the wild-type strain (Supplementary Movie S4). Meanwhile, the reversal frequency of the ΔcheA2 mutant (1.01 reversals) was similar to that of the wild-type strain (Supplementary Movies S5). These results revealed that the che1 cluster was essential for changing the swimming direction of the bacterial cells. The lower reversal frequency of the Δche2 mutant suggested that the che2 cluster also played a role in the swimming motility by decreasing the reorientation frequency.

2.4. The che2 Cluster was Involved in EPS Production

The genes controlling chemotaxis and motility in other systems have been reported to affect EPS production [23,30,45,46], an important factor in the establishment of rhizobia–legume symbiosis [47,48,49,50]. Thus, the production of EPS by the Δche1 and Δche2 mutants was further compared with that of the wild type. EPS production by the Δche2 mutant was approximately 57% lower than that of the wild type, while no qualitative or quantitative differences were observed between the wild type and the Δche1 mutant in EPS production (Figure 4). These data indicated that chemotaxis signaling via che2 modulated EPS production.

2.5. Both the Che Clusters Were Involved in the Competitive Colonization of S. cannabina Roots

Root colonization is the initial step in the establishment of the symbiotic association after initial signaling between plants and rhizobia [51]. Chemotaxis is an important competitive colonization trait, and chemotaxis toward the roots affects rhizobia–legume associations [32,33]. We examined the role of the two chemotaxis gene clusters of E. alkalisoli YIC4027T in root colonization. Seedlings that were 2 days old were placed in vermiculite containing a mixture of the wild-type and mutant strains with ratios of 1:1, 1:5, and 1:10 for 5 days. The bacterial strains that were recovered from the inoculated roots were enumerated. As shown in Figure 5, the wild type, when inoculated in numbers equal to each of the mutant strains, performed better than the two chemotaxis cluster mutants, the ratios of the Δche1 and Δche2 recovered cells being approximately 15% and 39% of that of the wild type, respectively (Figure 5). The number of Δche1 and Δche2 recovered cells could exceed that of the wild type when the inoculation was performed with a ratio of 1:5 or 1:10 wild type to mutants, the number of the bacteria colonizing the root system being more important in the case of the Δche2 mutant than in the case of the Δche1 mutant (Figure 5). These results suggested that the Δche1 mutant was more severely impaired in its competitive colonization ability than the Δche2 mutant.

2.6. Both the Che Clusters Modulated Competitive Nodulation

Root colonization is essential for the effective symbiotic nodulation of S. cannabina [51]. To further test whether the chemotaxis cluster mutants had any effect on symbiotic nodulation, the nodulation ability was compared between the wild type and the mutants. When inoculated alone in the roots of S. cannabina, the Δche1 and Δche2 mutants formed normal root nodules with no obvious differences between their number and morphology and those of the nodules induced by the wild type (Figure 6A). In addition, inoculated plant growth did not differ (Figure 6B). Furthermore, the competitive nodulation ability in the roots was compared between the wild type and the Δche1 and Δche2 mutants. Both the mutants were impaired in their ability to compete with the wild type for root nodulation no matter what ratio of bacterial wild-type–mutant strains was used for inoculation (Figure 6C,D).

3. Discussion

Ensifer alkalisoli YIC4027T, a dominant species in the saline–alkaline soils of the Yellow River Delta, establishes a nitrogen-fixing symbiosis within the roots of S. cannabina and possesses a high degree of nodulation competitiveness [5]. The two chemotaxis systems of YIC4027T may account for its high nodulation competitivity compared to that of the other rhizobia present in the same soil. In general, the chemotaxis pathways found in bacterial genomes have been found to regulate flagellar motility [22,24] as established, for example, in E. coli [52,53] or A. caulinodans ORS571 [23]. Many species of Alphaproteobacteria, however, carry more than one che cluster; Rhodobacter sphaeroides, for instance, carries three clusters containing chemotaxis genes, two of which can control the ability to stop flagellar rotation [54]. In E. alkalisoli YIC4027T, both the chemotaxis signaling pathways function in chemotaxis and the regulation of swimming reversal. The contribution of Che1 and Che2 to these behaviors are, however, significantly different: the che1 cluster is essential for chemotaxis responses and swimming reversal due to a lack of nontumbling ability, while the che2 cluster has a minor role in chemotaxis and swimming reversal. Interestingly, the che1 cluster of E. meliloti, which is very similar to that of E. alkalisoli, also controls chemotaxis and the swimming speed [34,55]. The role of the che2 cluster in this species remains, as of now, unknown. Since both the species are phylogenetically close, one could assume that the E. meliloti che2 cluster could have a role similar to that found in YIC4027T.
In particular, in this work, we reported a link between EPS synthesis and the chemotaxis cluster che2. The chemotaxis pathways have been implicated in EPS biosynthesis in other organisms, such as A. caulinodans ORS571 [23,41,45], A. brasilense [23,27], Myxococcus xanthus [56,57], and Nostoc punctiforme [58]. In A. caulinodans ORS571, several che genes were also shown to be involved in EPS production through an unknown mechanism [23,41,45]. In A. brasilense, a chemotaxis-like pathway of the ACF class was predicted to regulate EPS production [27]. In Myxococcus xanthus, the interactions between Dif and the Che7 pathway have been implicated in EPS production [56,57]. In Nostoc punctiforme, a chemotaxis-like gene cluster named hmp regulates EPS production by regulating the transcription of the hsp genes [58]. The data reported here also suggested that the che2 cluster in YIC4027T plays a role in the total amount of EPS produced as observed after the Congo red staining of the colonies and after quantitative determination. Further studies are needed to determine the mechanism underlying the link between chemotaxis and motility in the regulation of EPS biosynthesis. The synthesis of EPS as well as cyclic glucan has been extensively studied in E. meliloti, and a complex regulation circuitry involving quorum sensing has been shown [59,60]. So far, the involvement of the che2 cluster in EPS synthesis has not been shown in E. meliloti. It is possible that the two species have similar regulatory circuits that share common genetic determinants; however, this remains to be elucidated.
Chemotaxis and motility are important for the ability to colonize roots (e.g., in Azospirillum [24]) and, therefore, also for the symbiotic association of rhizobia with their host plant. According to the classification, the che1 cluster of E. alkalisoli YIC4027T is a representative of the F7 class (Fla group) of the chemotaxis system, which was shown to be more important in rhizospheric bacteria than in those occurring in bulk soils [19,61]. This chemotaxis system is thought to provide the bacterial strains with a competitive advantage in this environment [24]. In contrast, the che2 cluster of the YIC4027T strain belongs to the ACF evolutionary class [19]. The results suggested that this system has a newly discovered function in controlling EPS production and that it is important for competitive nodulation, thus indicating that this pathway also contributes to the rhizosphere lifestyle of this bacterial strain.
In conclusion, we demonstrated that the two chemotaxis clusters in E. alkalisoli YIC4027T have distinct roles. The che1 cluster is required for chemotaxis motility and competitive nodulation, while the che2 cluster provides a competitive advantage in root nodulation through the regulation of EPS biosynthesis. Finally, the role of che2 in chemotaxis and EPS production expands the range of cellular functions modulated by the chemosensory pathways.

4. Materials and Methods

4.1. Phylogenetic Analysis and Chemotaxis Cluster Comparative Analysis

The phylogenetic tree based on 16S rRNA locus was constructed with the neighbor-joining method using MEGA version 6.0 [62] with 1000 bootstrap replicates. The chemotaxis gene clusters in the bacterial genome were searched for in the Microbial Signal Transduction Database 3.0 (MIST3.0) (https://mistdb.com), which is allowed to access since November 2019 [39].

4.2. Bacterial Strains, Plasmids, and Culture Conditions

The bacterial strains and plasmids used in this study are listed in Table 1. Ensifer alkalisoli YIC4027T wild-type strain and its derivative strains were grown at 30 °C with shaking (180 rpm) in TY medium (5 g/L of tryptone, 3 g/L of yeast extract, and 0.83 g/L of CaCl2·2H2O) or in L3 minimal medium (10 mM KH2PO4, 100 µg/mL of MgSO4·7H2O, 40 µg/mL of CaCl2·2H2O, 5.4 µg/mL of FeCl3·6H2O, 50 µg/mL of NaCl, 5 µg/mL of Na2MoO4·2H2O, 2 µg/mL of biotin, 4 µg/mL of nicotinic acid, and 4 µg/mL of pantothenic acid) supplemented with 10 mM carbon source [63]. When appropriate, 25 µg/mL of nalidixic acid was added to the medium. Escherichia coli was grown in LB medium at 37 °C with the following concentrations of antibiotics as required: 50 µg/mL of kanamycin, 50 µg/mL of gentamycin, and 10 µg/mL of tetracycline.

4.3. Plasmid and Strain Construction

To construct a che1 cluster mutant, a 6595 bp DNA region from mcp to cheD was deleted from the genome of E. alkalisoli YIC4027T and was replaced with a gentamycin marker. This was achieved as follows: an 815 bp fragment upstream of che1, including 146 bp of the mcp gene, was amplified through PCR using the primer pair Che1UF and Che1UR (Table 2), and an 824 bp downstream fragment, including 222 bp of the cheD, was amplified through PCR using the primer pair Che1DF and Che1DR. The PCR product corresponding to the upstream DNA fragment was digested with KpnI-NdeI and then was cloned into plasmid pCM351 [64] to yield pCM351::UF. The PCR product corresponding to the downstream fragment was digested with ApaI-AgeI and was cloned into pCM351::UF. The resulting plasmid, pCM351::UF::DF, was used to transform E. coli DH5α, and the construction was checked through DNA sequencing. The recombinant plasmid was transferred into E. alkalisoli YIC4027T with the helper plasmid pRK2013 [65]. A deletion mutant resulting from double homologous recombination was obtained by screening the recombinants for gentamicin resistance and tetracycline sensitivity.
To construct a che2 gene cluster deletion mutant, a 3086 bp DNA region from cheR to cheB was deleted. To obtain such a mutant, an 810 bp upstream fragment, including 175 bp of cheR, was amplified through PCR from the genomic DNA of YIC4027T using the primer pair Che2UF and Che2UR, and a 686 bp downstream fragment, including 58 bp of cheB, was amplified through PCR using the primer pair Che2DF and Che2DR. The upstream fragment was digested with KpnI-NdeI and then was inserted into pCM351 to yield pCM351::UF2. The downstream fragment was digested with AgeI-SacI and then was cloned into pCM351::UF2. The plasmid pCM351::UF::DF2 was transferred into E. alkalisoli YIC4027T through triparental conjugation using pRK2013 as helper plasmid. Correct recombination was verified by screening for gentamicin resistance and tetracycline sensitivity as stated above.

4.4. Soft Agar Chemotaxis Assay

For the soft agar assay, YIC4027T wild type and Δche1, Δche2, ΔcheA1, and ΔcheA2 mutants were grown overnight in TY medium and then were washed three times with chemotaxis buffer (10 mM K2HPO4, 10 mM KH2PO4, and 0.1 mM EDTA [pH 7.0]) [66]. The cultures were then adjusted to an optical density of 1.0 at 600 nm (OD600). Thereafter, 5 μL aliquots of cell suspensions were stabbed into the L3 soft agar plates (0.3% agar) containing various 10 mM carbon sources, such as proline, succinate, and malate, with or without NH4Cl as a nitrogen source. Photographs were taken after 5 days of incubation at 30 °C. The diameter of the chemotaxis ring formed by each tested strain was measured. Experiments were performed three times, with three replicates per sample.

4.5. Growth Curve Assays

To compare the growth of YIC4027T wild type and Δche1 and Δche2 mutants, cell density was measured as previously described [7,67] with the following modifications: Cells were cultured overnight in TY medium at 30 °C with shaking (180 rpm). The cultures were washed three times with PBS buffer. Then, cells were inoculated in 50 mL of TY medium or in L3 medium containing 10 mM carbon sources and 10 mM NH4Cl and were adjusted to an OD600 of 0.02. Cultures were grown at 30 °C with shaking (180 rpm), and cell density at OD600 was monitored every 2 h. The experiment was carried out three times, with three replicates per sample.

4.6. Analysis of Swimming Behavior

Swimming behavior assay was performed as described in [68]. To test motility, YIC4027T wild type and Δche1, Δche2, ΔcheA1, and ΔcheA2 mutants were grown in rhizobium basal (RB) medium (3.9 mM KH2PO4, 6.1 mM K2HPO4, 1 mM (NH4)2SO4, 1 mM MgSO4, 0.1 mM NaCl, 0.1 mM CaCl2, 0.001 mM FeSO4, 0.01 mM Na2MoO4, 20 µg/L biotin, and 100 µg/L thiamine) with 0.2% mannitol as the sole carbon source [68]. After that, cells were resuspended in RB medium containing 10 mM proline as a chemotactic stimulant [7,68]. A total of 5 microliters of the suspension was introduced to a microscope slide, and the swimming behavior was recorded using an Olympus DP73 digital microscope camera on an Olympus BX53 system microscope at ×40 and ×100 magnifications. The swimming paths of each strain were manually tracked on video recordings by using ICY software [69]. Videos were analyzed to observe the cell paths for 3–4 s. The reorientation frequency was determined by counting the number of changes in swimming direction within 5 s per cell. The reorientation frequencies of at least 50 cells were measured in each experiment. For each strain, at least 3 independent experiments were performed.

4.7. Exopolysaccharide Production

For the examination of EPS production, YIC4027T wild type and Δche1 and Δche2 mutant strains were grown overnight and were adjusted to an OD600 of 1.0. Then 10 μL of bacterial suspension was dropped onto plates and incubated at 30 °C for 5 days. Qualitative production of EPS was examined on L3 or TY 0.8% agar plates containing Congo red (40 μg/mL) as described previously [64]. Quantification of EPS production was performed with the anthrone method according to Nakajima et al. [64] using modifications described in [64]. EPS concentration was determined at OD620 by referencing a D-glucose standard curve.

4.8. Root Colonization Assay

Sesbania cannabina seeds were surface sterilized with concentrated sulfuric acid for 30 min and then washed 5 times with sterile water. The seeds were germinated through incubation in the dark on inverted water–agar plates for 2 days at 30 °C. Two germinated seedlings were planted in vermiculite growth chamber and were moisturized with Fahraeus mineral solution (0.1 g/L of CaCl2; 0.12 g/L of MgSO4·7H2O; 0.15 g/L of Na2HPO4·2H2O; 0.1 g/L of KH2PO4; 5 mg/L of Fe-citrate; and 0.07 mg/L each of CuSO4·5H2O, MnCl2·4H2O, ZnCl2, H3BO3, and Na2MoO4·2H2O) [70]. Ensifer alkalisoli YIC4027T wild type and Δche1 and Δche2 mutants grown in TY medium were transferred to RB medium to find mid-log exponential phase and to ensure motility. Then, the cells were washed and suspended at OD600 = 0.4 in Fahraeus medium. YIC4027T wild type was mixed with Δche1 or Δche2 mutant strain, respectively, at ratios of 1:1, 1:5, and 1:10. Two microliters of the bacterial mixtures were then inoculated in the center of the vermiculite growth chamber. Each of the 6 treatments was applied to 5 chambers, and the assay was repeated 3 times. The roots were harvested after 5 days, and serial dilutions of the homogenized root samples were plated in TY medium containing nalidixic acid. After 2 days of growth at 30 °C, colonies were further identified through PCR using the primer pairs CheA1-F and CheA1-R or CheA2-F and CheA2-R (Table 2). For each competition experiment, at least 100 colonies were verified through PCR.

4.9. Nodulation and Competitive Nodulation Assays

Nodulation and competitive nodulation assays were carried out as previously described [71] with the following modifications: Ensifer alkalisoli YIC4027T wild type and Δche1 and Δche2 mutant strains were grown in RB medium to find mid-log phase. Afterwards, centrifugation cells were washed 3 times with Fahraeus mineral solution at an OD600 of 0.4. YIC4027T wild type was mixed with Δche1 or Δche2 mutant, respectively, in 1:1, 1:5, and 1:10 ratios. The mixture and each strain alone were inoculated with germinated seedlings of S. cannabina planted as described above. Each treatment was applied to 10 chambers and was repeated at least 3 times. Plants were grown at 27 °C in the greenhouse with a daylight illumination period of 12 h for 5 weeks and were watered with sterile distilled water every 5 to 7 days. Nodules were harvested, surface sterilized with H2O2 (20%) for 10 min, and rinsed with sterilized water 5 times [71]. Then, the nodules were crushed and were plated in TY agar plates supplemented with nalidixic acid. Finally, the colonies were verified by PCR through the use of primer pairs CheA1-F and CheA1-R or CheA2-F and CheA2-R (Table 2).

4.10. Statistical Analysis

To compare the YIC4027T wild type and mutant phenotypes (chemotaxis, swimming behavior, and EPS quantitation assay), statistical analysis was performed via a one-way analysis of variance by using Statistical Package for the Social Sciences (SPSS) 17.0 software package (IBM, New York, USA). A Student’s t-test assuming equal variances was used to calculate the p values of two means. p values < 0.05 were considered to be significant differences. Each experiment was repeated at least three times.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/agronomy13020570/s1: Movie S1: Swimming paths of YIC4027T wild-type strain. The cells are hyperactive with long runs alternating with sudden changes in swimming direction. Movie S2: Swimming paths of Δche1 mutant cells. The cells are swimming in straight lines without direction changes. Movie S3: Swimming paths of ΔcheA1 mutant cells. Nearly all cells are swimming in straight lines without direction changes. Movie S4: Swimming paths of Δche2 mutant cells. The cells are hyperactive with long runs alternating with sudden direction changes. Movie S5: Swimming paths of ΔcheA2 mutant cells. The cells are hyperactive with long runs alternating with sudden direction changes. Figure S1. Growth curves of YIC4027T wild type and Δche1 and Δche2 mutant strains in TY medium (A) or L3 minimal medium containing 10 mM proline and 10 mM NH4Cl (B). OD600 was measured every two hours. Error bars represent standard deviations of the means of three repetitions.

Author Contributions

Conceptualization, T.G., Y.Z. and Z.X.; methodology, T.G. and Y.Z.; formal analysis, T.G.; data curation, Y.Z. and Z.X.; writing—original draft preparation, T.G.; writing—review and editing, T.G., Y.Z., F.M. and Z.X.; funding acquisition, Z.X. and Y.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Key Research and Development Program of China (2022YFD1201700), National Natural Science Foundation of China (32270065), and the Shandong Key Research and Development Program (2021CXGC010804).

Data Availability Statement

The data are contained within the article.

Acknowledgments

We thank Claudine Elmerich for help in improving the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dwivedi, S.L.; Sahrawat, K.L.; Upadhyaya, H.D.; Mengoni, A.; Galardin, M.; Bazzicalupo, M.; Biondi, E.G.; Hungria, M.; Kaschuk, G.; Blair, M.W.; et al. Advances in host plant and Rhizobium genomics to enhance symbiotic nitrogen fixation in grain legumes. Adv. Agron. 2015, 129, 1–116. [Google Scholar]
  2. Udvardi, M.; Poole, P.S. Transport and metabolism in legume-Rhizobia symbioses. Ann. Rev. Plant Biol. 2013, 64, 781–805. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Ye, Z.H.; Yang, Z.Y.; Chan, G.Y.S.; Wong, M.H. Growth response of Sesbania rostrata and S. cannabina to sludge-amended lead/zinc mine tailings: A greenhouse study. Environ. Int. 2001, 26, 449–455. [Google Scholar] [CrossRef] [PubMed]
  4. Allen, O.N.; Allen, E.K. The Leguminosae, a Source Book of Characteristics, Uses and Nodulation; The University of Wisconsin Press: Madison, WI, USA, 1981; Volume 8, p. 12. [Google Scholar]
  5. Li, Y.; Li, X.; Liu, Y.; Wang, E.; Ren, C.; Liu, W.; Xu, H.; Wu, H.; Jiang, N.; Li, Y.; et al. Genetic diversity and community structure of rhizobia nodulating Sesbania cannabina in saline-alkaline soils. Syst. Appl. Microbiol. 2016, 39, 195–202. [Google Scholar] [CrossRef]
  6. Li, Y.; Yan, J.; Yu, B.; Wang, E.; Li, X.; Yan, H.; Liu, W.; Xie, Z. Ensifer alkalisoli sp. nov. isolated from root nodules of Sesbania cannabina grown in saline-alkaline soils. Int. J. Syst. Evol. Microbiol. 2016, 66, 5294–5300. [Google Scholar] [CrossRef] [PubMed]
  7. Dang, X.; Xie, Z.; Liu, W.; Sun, Y.; Liu, X.; Zhu, Y.; Staehelin, C. The genome of Ensifer alkalisoli YIC4027 provides insights for host specificity and environmental adaptations. BMC Genom. 2019, 20, 643. [Google Scholar] [CrossRef] [Green Version]
  8. Scharf, B.E.; Hynes, M.F.; Alexandre, G.M. Chemotaxis signaling systems in model beneficial plant-bacteria associations. Plant Mol. Biol. 2016, 90, 549–559. [Google Scholar] [CrossRef]
  9. Feng, H.; Zhang, N.; Du, W.; Zhang, H.; Liu, Y.; Fu, R.; Shao, J.; Zhang, G.; Shen, Q.; Zhang, R. Identification of chemotaxis compounds in root exudates and their sensing chemoreceptors in plant-growth-promoting rhizobacteria Bacillus amyloliquefaciens SQR9. Mol. Plant Microbe Interact. 2018, 31, 995–1005. [Google Scholar] [CrossRef] [Green Version]
  10. Wadhams, G.H.; Armitage, J.P. Making sense of it all: Bacterial chemotaxis. Nat. Rev. Mol. Cell Biol. 2004, 5, 1024–1037. [Google Scholar] [CrossRef] [PubMed]
  11. Parkinson, J.S.; Kofoid, E.C. Communication modules in bacterial signaling proteins. Ann. Rev. Gen. 1992, 26, 71–112. [Google Scholar] [CrossRef]
  12. Hazelbauer, G.L.; Falke, J.J.; Parkinson, J.S. Bacterial chemoreceptors: High-performance signaling in networked arrays. Trends Biochem. Sci. 2008, 33, 9–19. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Sourjik, V.; Wingreen, N.S. Responding to chemical gradients: Bacterial chemotaxis. Curr. Opin. Cell Biol. 2012, 24, 262–268. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  14. Stock, J.; Da, R.S. Signal transduction: Response regulators on and off. Curr. Biol. 2000, 10, R420–R424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  15. Karatan, E.; Saulmon, M.M.; Bunn, N.W.; Ordal, G.W. Phosphorylation of the response regulator CheV is required for adaptation to attractants during Bacillus subtilis chemotaxis. J. Biol. Chem. 2001, 276, 43618–43626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Szurmant, H.; Muff, T.J.; Ordal, G.W. Bacillus subtilis CheC and FliY are members of a novel class of CheY-P-hydrolyzing proteins in the chemotactic signal transduction cascade. J. Biol. Chem. 2004, 279, 21787–21792. [Google Scholar] [CrossRef] [Green Version]
  17. Rosario, M.M.L.; Ordal, G.W. CheC and CheD interact to regulate methylation of Bacillus subtilis methyl-accepting chemotaxis proteins. Mol. Microbiol. 1996, 21, 511–518. [Google Scholar] [CrossRef]
  18. Ortega, D.R.; Kjær, A.; Briegel, A. The chemosensory systems of Vibrio cholerae. Mol. Microbiol. 2020, 114, 367–376. [Google Scholar] [CrossRef]
  19. Wuichet, K.; Zhulin, I.B. Origins and diversification of a complex signal transduction system in Prokaryotes. Sci. Signal. 2010, 3, Ra50. [Google Scholar] [CrossRef] [Green Version]
  20. Hamer, R.; Chen, P.Y.; Armitage, J.P.; Reinert, G.; Deane, C.M. Deciphering chemotaxis pathways using cross species comparisons. BMC Syst. Biol. 2010, 4, 3. [Google Scholar] [CrossRef] [Green Version]
  21. Porter, S.L.; Wadhams, G.H.; Armitage, J.P. Rhodobacter sphaeroides: Complexity in chemotactic signalling. Trends Microbiol. 2008, 16, 251–260. [Google Scholar] [CrossRef]
  22. Whitchurch, C.B.; Leech, A.J.; Young, M.D.; Kennedy, D.; Sargent, J.L.; Bertrand, J.J.; Semmler, A.B.; Mellick, A.S.; Martin, P.R.; Alm, R.A.; et al. Characterization of a complex chemosensory signal transduction system which controls twitching motility in Pseudomonas aeruginosa. Mol. Microbiol. 2004, 52, 873–893. [Google Scholar] [CrossRef] [PubMed]
  23. Liu, W.; Sun, Y.; Shen, R.; Dang, X.; Liu, X.; Sui, F.; Li, Y.; Zhang, Z.; Alexandre, G.; Elmerich, C.; et al. A Chemotaxis-Like Pathway of Azorhizobium caulinodans controls flagella-driven motility, which regulates biofilm formation, exopolysaccharide biosynthesis, and competitive nodulation. Mol. Plant Microbe Interact. 2018, 31, 737–749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Mukherjee, T.; Kumar, D.; Burriss, N.; Xie, Z.; Alexandre, G. Azospirillum brasilense chemotaxis depends on two signaling pathways regulating distinct motility parameters. J. Bacteriol. 2016, 198, 1764–1772. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. He, K.; Bauer, C.E. Chemosensory signaling systems that control bacterial survival. Trends Microbiol. 2014, 22, 389–398. [Google Scholar] [CrossRef] [Green Version]
  26. He, K.; Dragnea, V.; Bauer, C.E. Adenylate charge regulates sensor kinase CheS3 to control cyst formation in Rhodospirillum centenum. mBio 2015, 6, e00546-15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  27. Bible, A.; Russell, M.H.; Alexandre, G. The Azospirillum brasilense Che1 chemotaxis pathway controls swimming velocity, which affects transient cell-to-cell clumping. J. Bacteriol. 2012, 194, 3343–3355. [Google Scholar] [CrossRef] [Green Version]
  28. Siuti, P.; Green, C.; Edwards, A.N.; Doktycz, M.J.; Alexandre, G. The chemotaxis-like Che1 pathway has an indirect role in adhesive cell properties of Azospirillum brasilense. FEMS Microbiol. Lett. 2011, 323, 105–112. [Google Scholar] [CrossRef] [Green Version]
  29. Wang, Y.H.; Huang, Z.; Liu, S.J. Chemotaxis towards aromatic compounds: Insights from Comamonas testosteroni. Int. J. Mol. Sci. 2019, 20, 2701. [Google Scholar] [CrossRef] [Green Version]
  30. Hickman, J.W.; Tifrea, D.F.; Harwood, C.S. A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc. Natl. Acad. Sci. USA 2005, 102, 14422–14427. [Google Scholar] [CrossRef] [Green Version]
  31. Matilla, M.A.; Martín-Mora, D.; Gavira, J.A.; Krell, T. Pseudomonas aeruginosa as a model to study chemosensory pathway signaling. Microbiol. Mol. Biol. 2021, 85, e00151-20. [Google Scholar] [CrossRef]
  32. de Weert, S.; Vermeiren, H.; Mulders, I.H.M.; Kuiper, I.; Hendrickx, N.; Bloemberg, G.V.; Vanderleyden, J.; De Mot, R.; Lugtenberg, B.J.J. Flagella-driven chemotaxis towards exudate components is an important trait for tomato root colonization by Pseudomonas fluorescens. Mol. Plant Microbe Interact. 2002, 15, 1173–1180. [Google Scholar] [CrossRef] [Green Version]
  33. Greer-Phillips, S.E.; Stephens, B.B.; Alexandre, G. An energy taxis transducer promotes root colonization by Azospirillum brasilense. J. Bacteriol. 2004, 186, 6595–6604. [Google Scholar] [CrossRef] [Green Version]
  34. Greck, M.; Platzer, J.; Sourjik, V.; Schmitt, R. Analysis of a chemotaxis operon in Rhizobium meliloti. Mol. Microbiol. 1995, 15, 989–1000. [Google Scholar] [CrossRef]
  35. Miller, L.D.; Yost, C.K.; Hynes, M.F.; Alexandre, G. The major chemotaxis gene cluster of Rhizobium leguminosarum bv. viciae is essential for competitive nodulation. Mol. Microbiol. 2007, 63, 348–362. [Google Scholar] [CrossRef] [PubMed]
  36. Wright, E.L.; Deakin, W.J.; Shaw, C.H. A chemotaxis cluster from Agrobacterium tumefaciens. Gene 1998, 220, 83–89. [Google Scholar] [CrossRef]
  37. González, V.; Santamaría, R.I.; Bustos, P.; Hernández-González, I.; Medrano-Soto, A.; Moreno-Hagelsieb, G.; Janga, S.C.; Ramírez, M.A.; Jiménez-Jacinto, V.; Collado-Vides, J.; et al. The partitioned Rhizobium etli genome: Genetic and metabolic redundancy in seven interacting replicons. Proc. Natl. Acad. Sci. USA 2006, 103, 3834–3839. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  38. Parkinson, J.S.; Hazelbauer, G.L.; Falke, J.J. Signaling and sensory adaptation in Escherichia coli chemoreceptors: 2015 update. Trends Microbiol. 2015, 23, 257–266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Gumerov, V.M.; Ortega, D.R.; Adebali, O.; Ulrich, L.E.; Zhulin, I.B. MiST 3.0: An updated microbial signal transduction database with an emphasis on chemosensory systems. Nucleic Acids Res. 2019, 48, D459–D464. [Google Scholar] [CrossRef] [Green Version]
  40. Barnett, M.J.; Fisher, R.F.; Jones, T.; Komp, C.; Abola, A.P.; Barloy-Hubler, F.; Bowser, L.; Capela, D.; Galibert, F.; Gouzy, J.; et al. Nucleotide sequence and predicted functions of the entire Sinorhizobium meliloti pSymA megaplasmid. Proc. Natl. Acad. Sci. USA 2001, 98, 9883–9888. [Google Scholar] [CrossRef] [Green Version]
  41. Meier, V.M.; Scharf, B.E. Cellular localization of predicted transmembrane and soluble chemoreceptors in Sinorhizobium meliloti. J. Bacteriol. 2009, 191, 5724–5733. [Google Scholar] [CrossRef] [Green Version]
  42. Liu, X.; Liu, W.; Sun, Y.; Xia, C.; Elmerich, C.; Xie, Z. A cheZ-like gene in Azorhizobium caulinodans is a key gene in the control of chemotaxis and colonization of the host plant. Appl. Environ. Microbiol. 2018, 84, e01827-17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Bible, A.N.; Stephens, B.B.; Ortega, D.R.; Xie, Z.; Alexandre, G. Function of a chemotaxis-like signal transduction pathway in modulating motility, cell clumping, and cell length in the Alphaproteobacterium Azospirillum brasilense. J. Bacteriol. 2008, 190, 6365–6375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. de Beyer, J.A.; Szöllössi, A.; Byles, E.; Fischer, R.; Armitage, J.P. Mechanism of signalling and adaptation through the Rhodobacter sphaeroides cytoplasmic chemoreceptor cluster. Int. J. Mol. Sci. 2019, 20, 5095. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  45. Liu, W.; Bai, X.; Li, Y.; Min, J.; Kong, Y.; Hu, X. CheY1 and CheY2 of Azorhizobium caulinodans ORS571 regulate chemotaxis and competitive colonization with the host plant. Appl. Environ. Microbiol. 2020, 86, e00599-20. [Google Scholar] [CrossRef] [PubMed]
  46. Merritt, P.M.; Danhorn, T.; Fuqua, C. Motility and chemotaxis in Agrobacterium tumefaciens surface attachment and biofilm formation. J. Bacteriol. 2007, 189, 8005–8014. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Leigh, J.A.; Signer, E.R.; Walker, G.C. Exopolysacchride-deficeint mutants of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. USA 1985, 82, 6231–6235. [Google Scholar] [CrossRef] [Green Version]
  48. Hotter, G.S.; Scott, D.B. Exopolysacchride mutants of Rhizobium loti are fully effective on a determinate nodulating host but are ineffective on an indeterminate nodulating host. J. Bacteriol. 1991, 173, 851–859. [Google Scholar] [CrossRef] [Green Version]
  49. Geddes, B.A.; Gonzalez, J.E.; Oresnik, I.J. Exopolysaccharide production in response to medium acidification is correlated with an increase in competition for nodule occupancy. Mol. Plant Microbe Interact. 2014, 27, 1307–1317. [Google Scholar] [CrossRef] [Green Version]
  50. Janczarek, M.; Rachwał, K.; Turska-Szewczuk, A. A mutation in pssE affects exopolysaccharide synthesis by Rhizobium leguminosarum bv. trifolii, its surface properties, and symbiosis with clover. Plant Soil 2017, 417, 331–347. [Google Scholar] [CrossRef] [Green Version]
  51. Feng, H.; Fu, R.; Hou, X.; Lv, Y.; Zhang, N.; Liu, Y.; Xu, Z.; Miao, Y.; Krell, T.; Shen, Q.; et al. Chemotaxis of beneficial rhizobacteria to root exudates: The first step towards root–microbe rhizosphere interactions. Int. J. Mol. Sci. 2021, 22, 6655. [Google Scholar] [CrossRef]
  52. Parkinson, J.S. Complementation analysis and deletion mapping of Escherichia coli mutants defective in chemotaxis. J. Bacteriol. 1978, 135, 45–53. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Parkinson, J.S. cheA, cheB, and cheC genes of Escherichia coli and their role in chemotaxis. J. Bacteriol. 1976, 126, 756–770. [Google Scholar] [CrossRef] [Green Version]
  54. Hamblin, P.A.; Maguire, B.A.; Grishanin, R.N.; Armitage, J.P. Evidence for two chemosensory pathways in Rhodobacter sphaeroides. Mol. Microbiol. 1997, 26, 1083–1096. [Google Scholar] [CrossRef] [PubMed]
  55. Sourjik, V.; Schmitt, R. Different roles of CheY1 and CheY2 in the chemotaxis of Rhizobium meliloti. Mol. Microbiol. 1996, 22, 427–436. [Google Scholar] [CrossRef] [PubMed]
  56. Campodonico, E.M.; Zusman, D.R. Developments in defining dif. J. Bacteriol. 2010, 192, 4264–4266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  57. Black, W.P.; Xu, Q.; Cadieux, C.L.; Suh, S.J.; Shi, W.; Yang, Z. Isolation and characterization of a suppressor mutation that restores Myxococcus xanthus exopolysaccharide production. Microbiology 2009, 155, 3599–3610. [Google Scholar] [CrossRef] [Green Version]
  58. Risser, D.D.; Chew, W.G.; Meeks, J.C. Genetic characterization of the hmp locus, a chemotaxis-like gene cluster that regulates hormogonium development and motility in Nostoc punctiforme. Mol. Microbiol. 2014, 92, 222–233. [Google Scholar] [CrossRef]
  59. Marketon, M.M.; Sarah, A.G.; Anatol, E.; González, J.E. Quorum sensing controls exopolysaccharide production in Sinorhizobium meliloti. J. Bacteriol. 2003, 185, 325–331. [Google Scholar] [CrossRef] [Green Version]
  60. Baena, I.; Pérez-Mendoza, D.; Sauviac, L.; Francesch, K.; Martín, M.; Rivilla, R.; Bonilla, I.; Bruand, C.; Sanjuán, J.; Llore, J. A partner-switching system controls activation of mixed-linkage beta-glucan synthesis by c-di-GMP in Sinorhizobium meliloti. Environ. Microbiol. 2019, 21, 3379–3391. [Google Scholar] [CrossRef] [Green Version]
  61. Buchan, A.; Crombie, B.; Alexandre, G.M. Temporal dynamics and genetic diversity of chemotactic-competent microbial populations in the rhizosphere. Environ. Microbiol. 2010, 12, 3171–3184. [Google Scholar] [CrossRef]
  62. Tamura, K.; Steche, G.; Peterso, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  63. Nakajima, A.; Aono, T.; Tsukada, S.; Siarot, L.; Ogawa, T.; Oyaizu, H. Lon protease of Azorhizobium caulinodans ORS571 is required for suppression of reb gene expression. Appl. Environl. Microbiol. 2012, 78, 6251–6261. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Marx, C.J.; Lidstrom, M.E. Broad-host-range cre-lox system for antibiotic marker recycling in Gram-negative bacteria. BioTechniques 2002, 33, 1062–1067. [Google Scholar] [CrossRef] [Green Version]
  65. Figurski, D.H.; Helinski, D.R. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 1979, 76, 1648–1652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Alexandre, G.; Greer, S.E.; Zhulin, I.B. Energy taxis is the dominant behavior in Azospirillum brasilense. J. Bacteriol. 2000, 182, 6042–6048. [Google Scholar] [CrossRef] [Green Version]
  67. Liu, W.; Yang, J.; Sun, Y.; Liu, X.; Li, Y.; Zhang, Z.; Xie, Z. Azorhizobium caulinodans transmembrane chemoreceptor TlpA1 involved in host colonization and nodulation on roots and stems. Front. Microbiol. 2017, 8, 1327. [Google Scholar] [CrossRef] [Green Version]
  68. Götz, R.; Schmitt, R. Rhizobium meliloti swims by unidirectional, intermittent rotation of right-handed flagellar helices. J. Bacteriol. 1977, 169, 3146–3150. [Google Scholar] [CrossRef] [Green Version]
  69. de Chaumont, F.; Dallongeville, S.; Chenouard, N.; Hervé, N.; Pop, S.; Provoost, T.; Meas-Yedid, V.; Pankajakshan, P.; Lecomte, T.; Montagner, Y.L.; et al. Icy: An open bioimage informatics platform for extended reproducible research. Nat. Methods 2012, 9, 690–696. [Google Scholar] [CrossRef]
  70. Fahraeus, G. The infection of clover root hairs by nodule bacteria studied by a simple glass slide technique. J. Gen. Microbiol. 1957, 16, 374–381. [Google Scholar] [CrossRef] [Green Version]
  71. Salas, M.E.; Lozano, M.J.; Lopez, J.E.; Draghi, W.O.; Serrania, J.; Torres, T.G.A.; Albicoro, F.J.; Nilsson, J.F.; Pistorio, M.; Del Papa, M.F.; et al. Specificity traits consistent with legume-rhizobia coevolution displayed by Ensifer meliloti rhizosphere colonization. Environ. Microbiol. 2017, 19, 3423–3438. [Google Scholar] [CrossRef] [Green Version]
Figure 1. Genetic organization of the chemotaxis gene clusters of E. alkalisoli YIC4027T and comparison with other Alphaproteobacteria. (A) Genetic organization of the two chemotaxis gene clusters che1 and che2 within the E. alkalisoli YIC4027T genome (previously reported in [7]). The double-headed arrow line below each cluster indicates the deleted region in each che cluster mutant that yielded Δche1 and Δche2 mutant strains (see methods). The triangle indicates the insertion of the GmR cassette. GmR represents gentamicin resistance. Orf represents open reading frame. The open reading frames are drawn to scale. (B) Comparison of the chemotaxis gene clusters in the genome of E. alkalisoli YIC4027T and other Alphaproteobacteria. Enm represents Ensifer meliloti, Ena represents Ensifer alkalisoli, Rhl represents Rhizobium leguminosarum, Rhe represents Rhizobium etli, Agt represents Agrobacterium tumefaciens, Azc represents Azorhizobium caulinodans, Bj represents Bradyrhizobium japonicum, Rpp represents Rhodopseudomonas palustris, Rbs represents Rhodobacter sphaeroides, Asb represents Azospirillum brasilense, and Ec represents Escherichia coli. Chemotaxis genes were identified using the MIST3.0 database [39]. The phylogenetic tree was based on 16S rRNA sequences. Strain details are given in Table S1.
Figure 1. Genetic organization of the chemotaxis gene clusters of E. alkalisoli YIC4027T and comparison with other Alphaproteobacteria. (A) Genetic organization of the two chemotaxis gene clusters che1 and che2 within the E. alkalisoli YIC4027T genome (previously reported in [7]). The double-headed arrow line below each cluster indicates the deleted region in each che cluster mutant that yielded Δche1 and Δche2 mutant strains (see methods). The triangle indicates the insertion of the GmR cassette. GmR represents gentamicin resistance. Orf represents open reading frame. The open reading frames are drawn to scale. (B) Comparison of the chemotaxis gene clusters in the genome of E. alkalisoli YIC4027T and other Alphaproteobacteria. Enm represents Ensifer meliloti, Ena represents Ensifer alkalisoli, Rhl represents Rhizobium leguminosarum, Rhe represents Rhizobium etli, Agt represents Agrobacterium tumefaciens, Azc represents Azorhizobium caulinodans, Bj represents Bradyrhizobium japonicum, Rpp represents Rhodopseudomonas palustris, Rbs represents Rhodobacter sphaeroides, Asb represents Azospirillum brasilense, and Ec represents Escherichia coli. Chemotaxis genes were identified using the MIST3.0 database [39]. The phylogenetic tree was based on 16S rRNA sequences. Strain details are given in Table S1.
Agronomy 13 00570 g001
Figure 2. Chemotaxis behavior of E. alkalisoli YIC4027T wild type and deletion mutant strains, Δche1, Δche2, ΔcheA1, and ΔcheA2, in soft agar plates; WT represents YIC4027T wild type. (A) A representative of L3 plates with proline as the sole carbon source. (B) Size of chemotaxis diameter rings produced by wild type and deletion mutants on L3 plates with proline, succinate, or malate as carbon source and with (L3 + N) or without (L3 − N) NH4Cl as nitrogen source expressed as % of the wild type. Error bars represent standard deviations of the means of three repetitions. * represents p < 0.05 versus the WT strain; ** represents p < 0.01 versus the WT strain.
Figure 2. Chemotaxis behavior of E. alkalisoli YIC4027T wild type and deletion mutant strains, Δche1, Δche2, ΔcheA1, and ΔcheA2, in soft agar plates; WT represents YIC4027T wild type. (A) A representative of L3 plates with proline as the sole carbon source. (B) Size of chemotaxis diameter rings produced by wild type and deletion mutants on L3 plates with proline, succinate, or malate as carbon source and with (L3 + N) or without (L3 − N) NH4Cl as nitrogen source expressed as % of the wild type. Error bars represent standard deviations of the means of three repetitions. * represents p < 0.05 versus the WT strain; ** represents p < 0.01 versus the WT strain.
Agronomy 13 00570 g002
Figure 3. Analysis of swimming behaviors of E. alkalisoli YIC4027T and of Δche1, Δche2, ΔcheA1, and ΔcheA2 mutants. (A) Swimming trajectories of E. alkalisoli YIC4027T and its mutants. The tracks were obtained from digital microscope recordings and computerized motion analyses using image processing software (ICY) software (Bioimage Analysis, Paris, France). (B) Swimming reversal frequency. Reversals were determined with at least 50 free-swimming cells. Each strain was tested by using at least three independent experiments. Error bars indicate standard deviations of data of the independent experiments. * represents p < 0.05 versus the WT strain; ** represents p < 0.01 versus the WT strain.
Figure 3. Analysis of swimming behaviors of E. alkalisoli YIC4027T and of Δche1, Δche2, ΔcheA1, and ΔcheA2 mutants. (A) Swimming trajectories of E. alkalisoli YIC4027T and its mutants. The tracks were obtained from digital microscope recordings and computerized motion analyses using image processing software (ICY) software (Bioimage Analysis, Paris, France). (B) Swimming reversal frequency. Reversals were determined with at least 50 free-swimming cells. Each strain was tested by using at least three independent experiments. Error bars indicate standard deviations of data of the independent experiments. * represents p < 0.05 versus the WT strain; ** represents p < 0.01 versus the WT strain.
Agronomy 13 00570 g003
Figure 4. Extracellular polysaccharide (EPS) production of E. alkalisoli YIC4027T wild type and of Δche1 and Δche2 gene cluster mutants. (A) Colonies were grown for 5 days on TY or L3 medium plates containing 0.8% agar and 40 μg/mL of Congo red. (B) Quantitative determination of EPS produced by YIC4027T wild type and che mutants. Error bars represent standard deviations of three independent experiments. Asterisks indicate significant differences (p < 0.05) between the wild type and the mutants.
Figure 4. Extracellular polysaccharide (EPS) production of E. alkalisoli YIC4027T wild type and of Δche1 and Δche2 gene cluster mutants. (A) Colonies were grown for 5 days on TY or L3 medium plates containing 0.8% agar and 40 μg/mL of Congo red. (B) Quantitative determination of EPS produced by YIC4027T wild type and che mutants. Error bars represent standard deviations of three independent experiments. Asterisks indicate significant differences (p < 0.05) between the wild type and the mutants.
Agronomy 13 00570 g004
Figure 5. Competitive colonization ability of E. alkalisoli YIC4027TWT and mutant strains in the roots of S. cannabina. (A) Competitive colonization ability of WT and Δche1 gene cluster mutant. The x-axis indicates ratios between WT and Δche1 mutant. (B) Competitive colonization ability of WT and Δche2 gene cluster mutant. The x-axis indicates ratios between WT and Δche2 mutant. Error bars indicate standard deviations of three independent experiments.
Figure 5. Competitive colonization ability of E. alkalisoli YIC4027TWT and mutant strains in the roots of S. cannabina. (A) Competitive colonization ability of WT and Δche1 gene cluster mutant. The x-axis indicates ratios between WT and Δche1 mutant. (B) Competitive colonization ability of WT and Δche2 gene cluster mutant. The x-axis indicates ratios between WT and Δche2 mutant. Error bars indicate standard deviations of three independent experiments.
Agronomy 13 00570 g005
Figure 6. Nodulation assays of E. alkalisoli YIC4027T wild-type and mutant strains in the roots of S. cannabina. (A) Root nodules induced by WT and Δche1 and Δche2 mutant strains. (B) Representative photographs of the host plant S. cannabina inoculated with the wild type or Δche1 or Δche2 mutants alone. (C) Competitive nodulation ability of WT and Δche1 mutant. The x-axis indicates ratios between WT and Δche1 mutant. (D) Competitive nodulation ability of WT and Δche2 mutant. The plants were grown at 27 °C for 5 weeks. The x-axis indicates ratios between WT and Δche2 mutant. Error bars represent standard deviations of the means of three independent experiments.
Figure 6. Nodulation assays of E. alkalisoli YIC4027T wild-type and mutant strains in the roots of S. cannabina. (A) Root nodules induced by WT and Δche1 and Δche2 mutant strains. (B) Representative photographs of the host plant S. cannabina inoculated with the wild type or Δche1 or Δche2 mutants alone. (C) Competitive nodulation ability of WT and Δche1 mutant. The x-axis indicates ratios between WT and Δche1 mutant. (D) Competitive nodulation ability of WT and Δche2 mutant. The plants were grown at 27 °C for 5 weeks. The x-axis indicates ratios between WT and Δche2 mutant. Error bars represent standard deviations of the means of three independent experiments.
Agronomy 13 00570 g006
Table 1. Bacterial strains and plasmids used in this study.
Table 1. Bacterial strains and plasmids used in this study.
Strain or PlasmidRelevant PropertiesSource or Reference
Strains
E. coli
DH5αF_ supE44, lacA-U169, Ψ80 lacZ, ΔM15, hsdR17, recA1, endA1, gyrA96, thi-1 relA1Transgen
Ensifer alkalisoli
YIC 4027TWild-type strain, NalrLi et al. [6]
Δche1E. alkalisoli YIC 4027T derivative carrying a deletion in the che1 gene cluster from mcp to cheD, Nalr, GmrThis study (see Figure 1)
Δche2E. alkalisoli YIC 4027T derivative carrying a deletion in the che2 gene cluster from cheR to cheB, Nalr, GmrThis study (see Figure 1)
ΔcheA1E. alkalisoli YIC 4027T derivative carrying a deletion of cheA1, which encodes histidine kinase CheA1; Nalr; GmrDang et al. [7]
ΔcheA2E. alkalisoli YIC 4027T derivative carrying a deletion of cheA2, which encodes histidine kinase CheA2; Nalr; GmrDang et al. [7]
Plasmids
pCM351Mobilizable allelic exchange vector, Gmr, TcrMarx and Lidstrom [64]
pRK2013Helper plasmid, ColE1 replicon, Tra+, KmrFigurski and Helinski [65]
Nalr represents nalidixic acid resistance, Gmr represents gentamicin resistance, Tcr represents tetracycline resistance, and Kmr represents kanamycin resistance.
Table 2. Primers used in this study.
Table 2. Primers used in this study.
PrimerSequence (5′-3′) *Purpose
Che1UF-KpnIGGGGTACCGGTTGAGCGGTGAAGTGAAΔche1 construction
Che1UR-NdeIGGAATTCCATATGAACGCAAGCTCGATACGCΔche1 construction
Che1DF-ApaIGGGGGCCCGCTACGGCGTGCATCTGAΔche1 construction
Che1DR-AgeICGAGCTCGTGCGGCGGTATGAATGAΔche1 construction
Che2UF-KpnIGGGGTACCGTGACATTCTGACCGCTTTGGΔche2 construction
Che2UR-NdeIGGAATTCCATATGGGAAGAAGTGCGTTTCCCGTAΔche2 construction
Che2DF-AgeIGACCGGTCGAGGCCATAGGCGAGAAGΔche2 construction
Che2DR-SacICGAGCTCCAGGAACAAGACAGCCAAACGΔche2 construction
CheA1-FGTCAGCGGCACCACCAGAGTValidation of che1 and che2
CheA1-RCCAACAGGCTTGAACCCACAValidation of che1 and che2
CheA2-FGCGTCGGTACAGGAGATTGTGValidation of che1 and che2
CheA2-RGCGAGGAGTTGCGTGAGGATValidation of che1 and che2
* Engineered restriction sites are underlined.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Guo, T.; Zhou, Y.; Xie, Z.; Meng, F. The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation. Agronomy 2023, 13, 570. https://doi.org/10.3390/agronomy13020570

AMA Style

Guo T, Zhou Y, Xie Z, Meng F. The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation. Agronomy. 2023; 13(2):570. https://doi.org/10.3390/agronomy13020570

Chicago/Turabian Style

Guo, Tingting, Yanan Zhou, Zhihong Xie, and Fankai Meng. 2023. "The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation" Agronomy 13, no. 2: 570. https://doi.org/10.3390/agronomy13020570

APA Style

Guo, T., Zhou, Y., Xie, Z., & Meng, F. (2023). The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation. Agronomy, 13(2), 570. https://doi.org/10.3390/agronomy13020570

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop