The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation
Abstract
1. Introduction
2. Results
2.1. Comparative Organization of the Chemotaxis Clusters in E. alkalisoli YIC4027T and Other Alphaproteobacteria
2.2. Both the E. alkalisoli YIC4027T Chemotaxis Clusters were Involved in the Chemotactic Response toward Different Carbon Sources
2.3. The che1 Cluster was Mainly Involved in the Control of the Swimming Motility Behavior
2.4. The che2 Cluster was Involved in EPS Production
2.5. Both the Che Clusters Were Involved in the Competitive Colonization of S. cannabina Roots
2.6. Both the Che Clusters Modulated Competitive Nodulation
3. Discussion
4. Materials and Methods
4.1. Phylogenetic Analysis and Chemotaxis Cluster Comparative Analysis
4.2. Bacterial Strains, Plasmids, and Culture Conditions
4.3. Plasmid and Strain Construction
4.4. Soft Agar Chemotaxis Assay
4.5. Growth Curve Assays
4.6. Analysis of Swimming Behavior
4.7. Exopolysaccharide Production
4.8. Root Colonization Assay
4.9. Nodulation and Competitive Nodulation Assays
4.10. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dwivedi, S.L.; Sahrawat, K.L.; Upadhyaya, H.D.; Mengoni, A.; Galardin, M.; Bazzicalupo, M.; Biondi, E.G.; Hungria, M.; Kaschuk, G.; Blair, M.W.; et al. Advances in host plant and Rhizobium genomics to enhance symbiotic nitrogen fixation in grain legumes. Adv. Agron. 2015, 129, 1–116. [Google Scholar]
- Udvardi, M.; Poole, P.S. Transport and metabolism in legume-Rhizobia symbioses. Ann. Rev. Plant Biol. 2013, 64, 781–805. [Google Scholar] [CrossRef] [PubMed]
- Ye, Z.H.; Yang, Z.Y.; Chan, G.Y.S.; Wong, M.H. Growth response of Sesbania rostrata and S. cannabina to sludge-amended lead/zinc mine tailings: A greenhouse study. Environ. Int. 2001, 26, 449–455. [Google Scholar] [CrossRef] [PubMed]
- Allen, O.N.; Allen, E.K. The Leguminosae, a Source Book of Characteristics, Uses and Nodulation; The University of Wisconsin Press: Madison, WI, USA, 1981; Volume 8, p. 12. [Google Scholar]
- Li, Y.; Li, X.; Liu, Y.; Wang, E.; Ren, C.; Liu, W.; Xu, H.; Wu, H.; Jiang, N.; Li, Y.; et al. Genetic diversity and community structure of rhizobia nodulating Sesbania cannabina in saline-alkaline soils. Syst. Appl. Microbiol. 2016, 39, 195–202. [Google Scholar] [CrossRef]
- Li, Y.; Yan, J.; Yu, B.; Wang, E.; Li, X.; Yan, H.; Liu, W.; Xie, Z. Ensifer alkalisoli sp. nov. isolated from root nodules of Sesbania cannabina grown in saline-alkaline soils. Int. J. Syst. Evol. Microbiol. 2016, 66, 5294–5300. [Google Scholar] [CrossRef] [PubMed]
- Dang, X.; Xie, Z.; Liu, W.; Sun, Y.; Liu, X.; Zhu, Y.; Staehelin, C. The genome of Ensifer alkalisoli YIC4027 provides insights for host specificity and environmental adaptations. BMC Genom. 2019, 20, 643. [Google Scholar] [CrossRef]
- Scharf, B.E.; Hynes, M.F.; Alexandre, G.M. Chemotaxis signaling systems in model beneficial plant-bacteria associations. Plant Mol. Biol. 2016, 90, 549–559. [Google Scholar] [CrossRef]
- Feng, H.; Zhang, N.; Du, W.; Zhang, H.; Liu, Y.; Fu, R.; Shao, J.; Zhang, G.; Shen, Q.; Zhang, R. Identification of chemotaxis compounds in root exudates and their sensing chemoreceptors in plant-growth-promoting rhizobacteria Bacillus amyloliquefaciens SQR9. Mol. Plant Microbe Interact. 2018, 31, 995–1005. [Google Scholar] [CrossRef]
- Wadhams, G.H.; Armitage, J.P. Making sense of it all: Bacterial chemotaxis. Nat. Rev. Mol. Cell Biol. 2004, 5, 1024–1037. [Google Scholar] [CrossRef] [PubMed]
- Parkinson, J.S.; Kofoid, E.C. Communication modules in bacterial signaling proteins. Ann. Rev. Gen. 1992, 26, 71–112. [Google Scholar] [CrossRef]
- Hazelbauer, G.L.; Falke, J.J.; Parkinson, J.S. Bacterial chemoreceptors: High-performance signaling in networked arrays. Trends Biochem. Sci. 2008, 33, 9–19. [Google Scholar] [CrossRef] [PubMed]
- Sourjik, V.; Wingreen, N.S. Responding to chemical gradients: Bacterial chemotaxis. Curr. Opin. Cell Biol. 2012, 24, 262–268. [Google Scholar] [CrossRef] [PubMed]
- Stock, J.; Da, R.S. Signal transduction: Response regulators on and off. Curr. Biol. 2000, 10, R420–R424. [Google Scholar] [CrossRef] [PubMed]
- Karatan, E.; Saulmon, M.M.; Bunn, N.W.; Ordal, G.W. Phosphorylation of the response regulator CheV is required for adaptation to attractants during Bacillus subtilis chemotaxis. J. Biol. Chem. 2001, 276, 43618–43626. [Google Scholar] [CrossRef] [PubMed]
- Szurmant, H.; Muff, T.J.; Ordal, G.W. Bacillus subtilis CheC and FliY are members of a novel class of CheY-P-hydrolyzing proteins in the chemotactic signal transduction cascade. J. Biol. Chem. 2004, 279, 21787–21792. [Google Scholar] [CrossRef]
- Rosario, M.M.L.; Ordal, G.W. CheC and CheD interact to regulate methylation of Bacillus subtilis methyl-accepting chemotaxis proteins. Mol. Microbiol. 1996, 21, 511–518. [Google Scholar] [CrossRef]
- Ortega, D.R.; Kjær, A.; Briegel, A. The chemosensory systems of Vibrio cholerae. Mol. Microbiol. 2020, 114, 367–376. [Google Scholar] [CrossRef]
- Wuichet, K.; Zhulin, I.B. Origins and diversification of a complex signal transduction system in Prokaryotes. Sci. Signal. 2010, 3, Ra50. [Google Scholar] [CrossRef]
- Hamer, R.; Chen, P.Y.; Armitage, J.P.; Reinert, G.; Deane, C.M. Deciphering chemotaxis pathways using cross species comparisons. BMC Syst. Biol. 2010, 4, 3. [Google Scholar] [CrossRef]
- Porter, S.L.; Wadhams, G.H.; Armitage, J.P. Rhodobacter sphaeroides: Complexity in chemotactic signalling. Trends Microbiol. 2008, 16, 251–260. [Google Scholar] [CrossRef]
- Whitchurch, C.B.; Leech, A.J.; Young, M.D.; Kennedy, D.; Sargent, J.L.; Bertrand, J.J.; Semmler, A.B.; Mellick, A.S.; Martin, P.R.; Alm, R.A.; et al. Characterization of a complex chemosensory signal transduction system which controls twitching motility in Pseudomonas aeruginosa. Mol. Microbiol. 2004, 52, 873–893. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Sun, Y.; Shen, R.; Dang, X.; Liu, X.; Sui, F.; Li, Y.; Zhang, Z.; Alexandre, G.; Elmerich, C.; et al. A Chemotaxis-Like Pathway of Azorhizobium caulinodans controls flagella-driven motility, which regulates biofilm formation, exopolysaccharide biosynthesis, and competitive nodulation. Mol. Plant Microbe Interact. 2018, 31, 737–749. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, T.; Kumar, D.; Burriss, N.; Xie, Z.; Alexandre, G. Azospirillum brasilense chemotaxis depends on two signaling pathways regulating distinct motility parameters. J. Bacteriol. 2016, 198, 1764–1772. [Google Scholar] [CrossRef] [PubMed]
- He, K.; Bauer, C.E. Chemosensory signaling systems that control bacterial survival. Trends Microbiol. 2014, 22, 389–398. [Google Scholar] [CrossRef]
- He, K.; Dragnea, V.; Bauer, C.E. Adenylate charge regulates sensor kinase CheS3 to control cyst formation in Rhodospirillum centenum. mBio 2015, 6, e00546-15. [Google Scholar] [CrossRef] [PubMed]
- Bible, A.; Russell, M.H.; Alexandre, G. The Azospirillum brasilense Che1 chemotaxis pathway controls swimming velocity, which affects transient cell-to-cell clumping. J. Bacteriol. 2012, 194, 3343–3355. [Google Scholar] [CrossRef]
- Siuti, P.; Green, C.; Edwards, A.N.; Doktycz, M.J.; Alexandre, G. The chemotaxis-like Che1 pathway has an indirect role in adhesive cell properties of Azospirillum brasilense. FEMS Microbiol. Lett. 2011, 323, 105–112. [Google Scholar] [CrossRef]
- Wang, Y.H.; Huang, Z.; Liu, S.J. Chemotaxis towards aromatic compounds: Insights from Comamonas testosteroni. Int. J. Mol. Sci. 2019, 20, 2701. [Google Scholar] [CrossRef]
- Hickman, J.W.; Tifrea, D.F.; Harwood, C.S. A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc. Natl. Acad. Sci. USA 2005, 102, 14422–14427. [Google Scholar] [CrossRef]
- Matilla, M.A.; Martín-Mora, D.; Gavira, J.A.; Krell, T. Pseudomonas aeruginosa as a model to study chemosensory pathway signaling. Microbiol. Mol. Biol. 2021, 85, e00151-20. [Google Scholar] [CrossRef]
- de Weert, S.; Vermeiren, H.; Mulders, I.H.M.; Kuiper, I.; Hendrickx, N.; Bloemberg, G.V.; Vanderleyden, J.; De Mot, R.; Lugtenberg, B.J.J. Flagella-driven chemotaxis towards exudate components is an important trait for tomato root colonization by Pseudomonas fluorescens. Mol. Plant Microbe Interact. 2002, 15, 1173–1180. [Google Scholar] [CrossRef]
- Greer-Phillips, S.E.; Stephens, B.B.; Alexandre, G. An energy taxis transducer promotes root colonization by Azospirillum brasilense. J. Bacteriol. 2004, 186, 6595–6604. [Google Scholar] [CrossRef]
- Greck, M.; Platzer, J.; Sourjik, V.; Schmitt, R. Analysis of a chemotaxis operon in Rhizobium meliloti. Mol. Microbiol. 1995, 15, 989–1000. [Google Scholar] [CrossRef]
- Miller, L.D.; Yost, C.K.; Hynes, M.F.; Alexandre, G. The major chemotaxis gene cluster of Rhizobium leguminosarum bv. viciae is essential for competitive nodulation. Mol. Microbiol. 2007, 63, 348–362. [Google Scholar] [CrossRef] [PubMed]
- Wright, E.L.; Deakin, W.J.; Shaw, C.H. A chemotaxis cluster from Agrobacterium tumefaciens. Gene 1998, 220, 83–89. [Google Scholar] [CrossRef]
- González, V.; Santamaría, R.I.; Bustos, P.; Hernández-González, I.; Medrano-Soto, A.; Moreno-Hagelsieb, G.; Janga, S.C.; Ramírez, M.A.; Jiménez-Jacinto, V.; Collado-Vides, J.; et al. The partitioned Rhizobium etli genome: Genetic and metabolic redundancy in seven interacting replicons. Proc. Natl. Acad. Sci. USA 2006, 103, 3834–3839. [Google Scholar] [CrossRef] [PubMed]
- Parkinson, J.S.; Hazelbauer, G.L.; Falke, J.J. Signaling and sensory adaptation in Escherichia coli chemoreceptors: 2015 update. Trends Microbiol. 2015, 23, 257–266. [Google Scholar] [CrossRef] [PubMed]
- Gumerov, V.M.; Ortega, D.R.; Adebali, O.; Ulrich, L.E.; Zhulin, I.B. MiST 3.0: An updated microbial signal transduction database with an emphasis on chemosensory systems. Nucleic Acids Res. 2019, 48, D459–D464. [Google Scholar] [CrossRef]
- Barnett, M.J.; Fisher, R.F.; Jones, T.; Komp, C.; Abola, A.P.; Barloy-Hubler, F.; Bowser, L.; Capela, D.; Galibert, F.; Gouzy, J.; et al. Nucleotide sequence and predicted functions of the entire Sinorhizobium meliloti pSymA megaplasmid. Proc. Natl. Acad. Sci. USA 2001, 98, 9883–9888. [Google Scholar] [CrossRef]
- Meier, V.M.; Scharf, B.E. Cellular localization of predicted transmembrane and soluble chemoreceptors in Sinorhizobium meliloti. J. Bacteriol. 2009, 191, 5724–5733. [Google Scholar] [CrossRef]
- Liu, X.; Liu, W.; Sun, Y.; Xia, C.; Elmerich, C.; Xie, Z. A cheZ-like gene in Azorhizobium caulinodans is a key gene in the control of chemotaxis and colonization of the host plant. Appl. Environ. Microbiol. 2018, 84, e01827-17. [Google Scholar] [CrossRef] [PubMed]
- Bible, A.N.; Stephens, B.B.; Ortega, D.R.; Xie, Z.; Alexandre, G. Function of a chemotaxis-like signal transduction pathway in modulating motility, cell clumping, and cell length in the Alphaproteobacterium Azospirillum brasilense. J. Bacteriol. 2008, 190, 6365–6375. [Google Scholar] [CrossRef] [PubMed]
- de Beyer, J.A.; Szöllössi, A.; Byles, E.; Fischer, R.; Armitage, J.P. Mechanism of signalling and adaptation through the Rhodobacter sphaeroides cytoplasmic chemoreceptor cluster. Int. J. Mol. Sci. 2019, 20, 5095. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Bai, X.; Li, Y.; Min, J.; Kong, Y.; Hu, X. CheY1 and CheY2 of Azorhizobium caulinodans ORS571 regulate chemotaxis and competitive colonization with the host plant. Appl. Environ. Microbiol. 2020, 86, e00599-20. [Google Scholar] [CrossRef] [PubMed]
- Merritt, P.M.; Danhorn, T.; Fuqua, C. Motility and chemotaxis in Agrobacterium tumefaciens surface attachment and biofilm formation. J. Bacteriol. 2007, 189, 8005–8014. [Google Scholar] [CrossRef] [PubMed]
- Leigh, J.A.; Signer, E.R.; Walker, G.C. Exopolysacchride-deficeint mutants of Rhizobium meliloti that form ineffective nodules. Proc. Natl. Acad. Sci. USA 1985, 82, 6231–6235. [Google Scholar] [CrossRef]
- Hotter, G.S.; Scott, D.B. Exopolysacchride mutants of Rhizobium loti are fully effective on a determinate nodulating host but are ineffective on an indeterminate nodulating host. J. Bacteriol. 1991, 173, 851–859. [Google Scholar] [CrossRef]
- Geddes, B.A.; Gonzalez, J.E.; Oresnik, I.J. Exopolysaccharide production in response to medium acidification is correlated with an increase in competition for nodule occupancy. Mol. Plant Microbe Interact. 2014, 27, 1307–1317. [Google Scholar] [CrossRef]
- Janczarek, M.; Rachwał, K.; Turska-Szewczuk, A. A mutation in pssE affects exopolysaccharide synthesis by Rhizobium leguminosarum bv. trifolii, its surface properties, and symbiosis with clover. Plant Soil 2017, 417, 331–347. [Google Scholar] [CrossRef]
- Feng, H.; Fu, R.; Hou, X.; Lv, Y.; Zhang, N.; Liu, Y.; Xu, Z.; Miao, Y.; Krell, T.; Shen, Q.; et al. Chemotaxis of beneficial rhizobacteria to root exudates: The first step towards root–microbe rhizosphere interactions. Int. J. Mol. Sci. 2021, 22, 6655. [Google Scholar] [CrossRef]
- Parkinson, J.S. Complementation analysis and deletion mapping of Escherichia coli mutants defective in chemotaxis. J. Bacteriol. 1978, 135, 45–53. [Google Scholar] [CrossRef] [PubMed]
- Parkinson, J.S. cheA, cheB, and cheC genes of Escherichia coli and their role in chemotaxis. J. Bacteriol. 1976, 126, 756–770. [Google Scholar] [CrossRef]
- Hamblin, P.A.; Maguire, B.A.; Grishanin, R.N.; Armitage, J.P. Evidence for two chemosensory pathways in Rhodobacter sphaeroides. Mol. Microbiol. 1997, 26, 1083–1096. [Google Scholar] [CrossRef] [PubMed]
- Sourjik, V.; Schmitt, R. Different roles of CheY1 and CheY2 in the chemotaxis of Rhizobium meliloti. Mol. Microbiol. 1996, 22, 427–436. [Google Scholar] [CrossRef] [PubMed]
- Campodonico, E.M.; Zusman, D.R. Developments in defining dif. J. Bacteriol. 2010, 192, 4264–4266. [Google Scholar] [CrossRef] [PubMed]
- Black, W.P.; Xu, Q.; Cadieux, C.L.; Suh, S.J.; Shi, W.; Yang, Z. Isolation and characterization of a suppressor mutation that restores Myxococcus xanthus exopolysaccharide production. Microbiology 2009, 155, 3599–3610. [Google Scholar] [CrossRef]
- Risser, D.D.; Chew, W.G.; Meeks, J.C. Genetic characterization of the hmp locus, a chemotaxis-like gene cluster that regulates hormogonium development and motility in Nostoc punctiforme. Mol. Microbiol. 2014, 92, 222–233. [Google Scholar] [CrossRef]
- Marketon, M.M.; Sarah, A.G.; Anatol, E.; González, J.E. Quorum sensing controls exopolysaccharide production in Sinorhizobium meliloti. J. Bacteriol. 2003, 185, 325–331. [Google Scholar] [CrossRef]
- Baena, I.; Pérez-Mendoza, D.; Sauviac, L.; Francesch, K.; Martín, M.; Rivilla, R.; Bonilla, I.; Bruand, C.; Sanjuán, J.; Llore, J. A partner-switching system controls activation of mixed-linkage beta-glucan synthesis by c-di-GMP in Sinorhizobium meliloti. Environ. Microbiol. 2019, 21, 3379–3391. [Google Scholar] [CrossRef]
- Buchan, A.; Crombie, B.; Alexandre, G.M. Temporal dynamics and genetic diversity of chemotactic-competent microbial populations in the rhizosphere. Environ. Microbiol. 2010, 12, 3171–3184. [Google Scholar] [CrossRef]
- Tamura, K.; Steche, G.; Peterso, D.; Filipski, A.; Kumar, S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [PubMed]
- Nakajima, A.; Aono, T.; Tsukada, S.; Siarot, L.; Ogawa, T.; Oyaizu, H. Lon protease of Azorhizobium caulinodans ORS571 is required for suppression of reb gene expression. Appl. Environl. Microbiol. 2012, 78, 6251–6261. [Google Scholar] [CrossRef] [PubMed]
- Marx, C.J.; Lidstrom, M.E. Broad-host-range cre-lox system for antibiotic marker recycling in Gram-negative bacteria. BioTechniques 2002, 33, 1062–1067. [Google Scholar] [CrossRef]
- Figurski, D.H.; Helinski, D.R. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 1979, 76, 1648–1652. [Google Scholar] [CrossRef] [PubMed]
- Alexandre, G.; Greer, S.E.; Zhulin, I.B. Energy taxis is the dominant behavior in Azospirillum brasilense. J. Bacteriol. 2000, 182, 6042–6048. [Google Scholar] [CrossRef]
- Liu, W.; Yang, J.; Sun, Y.; Liu, X.; Li, Y.; Zhang, Z.; Xie, Z. Azorhizobium caulinodans transmembrane chemoreceptor TlpA1 involved in host colonization and nodulation on roots and stems. Front. Microbiol. 2017, 8, 1327. [Google Scholar] [CrossRef]
- Götz, R.; Schmitt, R. Rhizobium meliloti swims by unidirectional, intermittent rotation of right-handed flagellar helices. J. Bacteriol. 1977, 169, 3146–3150. [Google Scholar] [CrossRef]
- de Chaumont, F.; Dallongeville, S.; Chenouard, N.; Hervé, N.; Pop, S.; Provoost, T.; Meas-Yedid, V.; Pankajakshan, P.; Lecomte, T.; Montagner, Y.L.; et al. Icy: An open bioimage informatics platform for extended reproducible research. Nat. Methods 2012, 9, 690–696. [Google Scholar] [CrossRef]
- Fahraeus, G. The infection of clover root hairs by nodule bacteria studied by a simple glass slide technique. J. Gen. Microbiol. 1957, 16, 374–381. [Google Scholar] [CrossRef]
- Salas, M.E.; Lozano, M.J.; Lopez, J.E.; Draghi, W.O.; Serrania, J.; Torres, T.G.A.; Albicoro, F.J.; Nilsson, J.F.; Pistorio, M.; Del Papa, M.F.; et al. Specificity traits consistent with legume-rhizobia coevolution displayed by Ensifer meliloti rhizosphere colonization. Environ. Microbiol. 2017, 19, 3423–3438. [Google Scholar] [CrossRef]






| Strain or Plasmid | Relevant Properties | Source or Reference |
|---|---|---|
| Strains | ||
| E. coli | ||
| DH5α | F_ supE44, lacA-U169, Ψ80 lacZ, ΔM15, hsdR17, recA1, endA1, gyrA96, thi-1 relA1 | Transgen |
| Ensifer alkalisoli | ||
| YIC 4027T | Wild-type strain, Nalr | Li et al. [6] |
| Δche1 | E. alkalisoli YIC 4027T derivative carrying a deletion in the che1 gene cluster from mcp to cheD, Nalr, Gmr | This study (see Figure 1) |
| Δche2 | E. alkalisoli YIC 4027T derivative carrying a deletion in the che2 gene cluster from cheR to cheB, Nalr, Gmr | This study (see Figure 1) |
| ΔcheA1 | E. alkalisoli YIC 4027T derivative carrying a deletion of cheA1, which encodes histidine kinase CheA1; Nalr; Gmr | Dang et al. [7] |
| ΔcheA2 | E. alkalisoli YIC 4027T derivative carrying a deletion of cheA2, which encodes histidine kinase CheA2; Nalr; Gmr | Dang et al. [7] |
| Plasmids | ||
| pCM351 | Mobilizable allelic exchange vector, Gmr, Tcr | Marx and Lidstrom [64] |
| pRK2013 | Helper plasmid, ColE1 replicon, Tra+, Kmr | Figurski and Helinski [65] |
| Primer | Sequence (5′-3′) * | Purpose |
|---|---|---|
| Che1UF-KpnI | GGGGTACCGGTTGAGCGGTGAAGTGAA | Δche1 construction |
| Che1UR-NdeI | GGAATTCCATATGAACGCAAGCTCGATACGC | Δche1 construction |
| Che1DF-ApaI | GGGGGCCCGCTACGGCGTGCATCTGA | Δche1 construction |
| Che1DR-AgeI | CGAGCTCGTGCGGCGGTATGAATGA | Δche1 construction |
| Che2UF-KpnI | GGGGTACCGTGACATTCTGACCGCTTTGG | Δche2 construction |
| Che2UR-NdeI | GGAATTCCATATGGGAAGAAGTGCGTTTCCCGTA | Δche2 construction |
| Che2DF-AgeI | GACCGGTCGAGGCCATAGGCGAGAAG | Δche2 construction |
| Che2DR-SacI | CGAGCTCCAGGAACAAGACAGCCAAACG | Δche2 construction |
| CheA1-F | GTCAGCGGCACCACCAGAGT | Validation of che1 and che2 |
| CheA1-R | CCAACAGGCTTGAACCCACA | Validation of che1 and che2 |
| CheA2-F | GCGTCGGTACAGGAGATTGTG | Validation of che1 and che2 |
| CheA2-R | GCGAGGAGTTGCGTGAGGAT | Validation of che1 and che2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, T.; Zhou, Y.; Xie, Z.; Meng, F. The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation. Agronomy 2023, 13, 570. https://doi.org/10.3390/agronomy13020570
Guo T, Zhou Y, Xie Z, Meng F. The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation. Agronomy. 2023; 13(2):570. https://doi.org/10.3390/agronomy13020570
Chicago/Turabian StyleGuo, Tingting, Yanan Zhou, Zhihong Xie, and Fankai Meng. 2023. "The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation" Agronomy 13, no. 2: 570. https://doi.org/10.3390/agronomy13020570
APA StyleGuo, T., Zhou, Y., Xie, Z., & Meng, F. (2023). The Two Chemotaxis Gene Clusters of Ensifer alkalisoli YIC4027T, a Symbiont of Sesbania cannabina, Play Different Roles in Chemotaxis and Competitive Nodulation. Agronomy, 13(2), 570. https://doi.org/10.3390/agronomy13020570
