Novel Choline-Deficient and 0.1%-Methionine-Added High-Fat Diet Induces Burned-Out Metabolic-Dysfunction-Associated Steatohepatitis with Inflammation by Rapid Immune Cell Infiltration on Male Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Protocol for the MASH Diet Model
Nutritional Composition of the MASH Diet
2.2. Isolation of Immune Cells from Blood and the Liver
2.3. CyTOF Analysis
2.4. Biochemical Analysis
2.5. Liver Histology
2.6. Real-Time PCR
2.7. Western Blotting
2.8. Statistical Analysis
3. Results
3.1. MASH Diet Feeding Induced Hepatic Steatosis, Inflammation, and Tumorigenesis
3.2. MASH Diet Feeding Induced Hepatic Fibrosis in a Time-Dependent Manner
3.3. MASH Diet Feeding Induced Inflammation in the Early Stage
3.4. Effects of MASH Diet Feeding on Lipid Accumulation and De Novo Lipogenesis in the Liver
3.5. Effects of MASH Diet on Serum Components
3.6. Effects of MASH Diet on PGC-1α/β and Mitophagy
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Younossi, Z.M.; Golabi, P.; Paik, J.M.; Henry, A.; Van Dongen, C.; Henry, L. The Global Epidemiology of Nonalcoholic Fatty Liver Disease (NAFLD) and Nonalcoholic Steatohepatitis (NASH): A Systematic Review. Hepatology 2023, 77, 1335–1347. [Google Scholar] [CrossRef] [PubMed]
- Miao, L.; Targher, G.; Byrne, C.D.; Cao, Y.-Y.; Zheng, M.-H. Current Status and Future Trends of the Global Burden of MASLD. Trends Endocrinol. Metab. 2024, 35, 697–707. [Google Scholar] [CrossRef] [PubMed]
- Harrison, S.A.; Loomba, R.; Dubourg, J.; Ratziu, V.; Noureddin, M. Clinical Trial Landscape in NASH. Clin. Gastroenterol. Hepatol. 2023, 21, 2001–2014. [Google Scholar] [CrossRef] [PubMed]
- Harrison, S.A.; Allen, A.M.; Dubourg, J.; Noureddin, M.; Alkhouri, N. Challenges and Opportunities in NASH Drug Development. Nat. Med. 2023, 29, 562–573. [Google Scholar] [CrossRef]
- Hansen, H.H.; Feigh, M.; Veidal, S.S.; Rigbolt, K.T.; Vrang, N.; Fosgerau, K. Mouse Models of Nonalcoholic Steatohepatitis in Preclinical Drug Development. Drug Discov. Today 2017, 22, 1707–1718. [Google Scholar] [CrossRef]
- Vacca, M.; Kamzolas, I.; Harder, L.M.; Oakley, F.; Trautwein, C.; Hatting, M.; Ross, T.; Bernardo, B.; Oldenburger, A.; Hjuler, S.T.; et al. An Unbiased Ranking of Murine Dietary Models Based on Their Proximity to Human Metabolic Dysfunction-Associated Steatotic Liver Disease (MASLD). Nat. Metab. 2024, 6, 1178–1196. [Google Scholar] [CrossRef]
- Matsumoto, M.; Hada, N.; Sakamaki, Y.; Uno, A.; Shiga, T.; Tanaka, C.; Ito, T.; Katsume, A.; Sudoh, M. An Improved Mouse Model That Rapidly Develops Fibrosis in Non-alcoholic Steatohepatitis. Int. J. Exp. Pathol. 2013, 94, 93–103. [Google Scholar] [CrossRef]
- Brunt, E.M.; Kleiner, D.E.; Wilson, L.A.; Belt, P.; Neuschwander-Tetri, B.A. Nonalcoholic Fatty Liver Disease (NAFLD) Activity Score and the Histopathologic Diagnosis in NAFLD: Distinct Clinicopathologic Meanings. Hepatology 2011, 53, 810–820. [Google Scholar] [CrossRef]
- Liang, W.; Menke, A.L.; Driessen, A.; Koek, G.H.; Lindeman, J.H.; Stoop, R.; Havekes, L.M.; Kleemann, R.; van den Hoek, A.M. Establishment of a General NAFLD Scoring System for Rodent Models and Comparison to Human Liver Pathology. PLoS ONE 2014, 9, e115922. [Google Scholar] [CrossRef]
- Sugasawa, T.; Ono, S.; Yonamine, M.; Fujita, S.; Matsumoto, Y.; Aoki, K.; Nakano, T.; Tamai, S.; Yoshida, Y.; Kawakami, Y.; et al. One Week of CDAHFD Induces Steatohepatitis and Mitochondrial Dysfunction with Oxidative Stress in Liver. Int. J. Mol. Sci. 2021, 22, 5851. [Google Scholar] [CrossRef]
- Yamada, A.; Watanabe, A.; Nara, A.; Ishimaru, N.; Maeda, K.; Ido, Y.; Kotake, K.; Asano, M.; Shinohara, Y.; Yamamoto, T. Longitudinal Analysis of Mitochondrial Function in a Choline-Deficient L-Amino Acid-Defined High-Fat Diet-Induced Metabolic Dysfunction-Associated Steatohepatitis Mouse Model. Int. J. Mol. Sci. 2024, 25, 6193. [Google Scholar] [CrossRef] [PubMed]
- Buzzetti, E.; Pinzani, M.; Tsochatzis, E.A. The Multiple-Hit Pathogenesis of Non-Alcoholic Fatty Liver Disease (NAFLD). Metabolism 2016, 65, 1038–1048. [Google Scholar] [CrossRef] [PubMed]
- Ikawa-Yoshida, A.; Matsuo, S.; Kato, A.; Ohmori, Y.; Higashida, A.; Kaneko, E.; Matsumoto, M. Hepatocellular Carcinoma in a Mouse Model Fed a Choline-deficient, L-amino Acid-defined, High-fat Diet. Int. J. Exp. Pathol. 2017, 98, 221–233. [Google Scholar] [CrossRef] [PubMed]
- Kisoh, K.; Sugahara, G.; Ogawa, Y.; Furukawa, S.; Ishida, Y.; Okanoue, T.; Kohara, M.; Tateno, C. Estimating Drug Efficacy with a Diet-Induced NASH Model in Chimeric Mice with Humanized Livers. Biomedicines 2021, 9, 1647. [Google Scholar] [CrossRef] [PubMed]
- Hammerich, L.; Tacke, F. Hepatic Inflammatory Responses in Liver Fibrosis. Nat. Rev. Gastroenterol. Hepatol. 2023, 20, 633–646. [Google Scholar] [CrossRef]
- Xu, R.; Huang, H.; Zhang, Z.; Wang, F.-S. The Role of Neutrophils in the Development of Liver Diseases. Cell. Mol. Immunol. 2014, 11, 224–231. [Google Scholar] [CrossRef]
- Liang, W.; Lindeman, J.H.; Menke, A.L.; Koonen, D.P.; Morrison, M.; Havekes, L.M.; van den Hoek, A.M.; Kleemann, R. Metabolically Induced Liver Inflammation Leads to NASH and Differs from LPS- or IL-1β-Induced Chronic Inflammation. Lab. Investig. 2014, 94, 491–502. [Google Scholar] [CrossRef]
- O’Brien, K.M.; Allen, K.M.; Rockwell, C.E.; Towery, K.; Luyendyk, J.P.; Copple, B.L. IL-17A Synergistically Enhances Bile Acid-Induced Inflammation during Obstructive Cholestasis. Am. J. Pathol. 2013, 183, 1498–1507. [Google Scholar] [CrossRef]
- Ma, J.; Guillot, A.; Yang, Z.; Mackowiak, B.; Hwang, S.; Park, O.; Peiffer, B.J.; Ahmadi, A.R.; Melo, L.; Kusumanchi, P.; et al. Distinct Histopathological Phenotypes of Severe Alcoholic Hepatitis Suggest Different Mechanisms Driving Liver Injury and Failure. J. Clin. Investig. 2022, 132, e157780. [Google Scholar] [CrossRef]
- Calvente, C.J.; Tameda, M.; Johnson, C.D.; del Pilar, H.; Lin, Y.C.; Adronikou, N.; De Mollerat Du Jeu, X.; Llorente, C.; Boyer, J.; Feldstein, A.E. Neutrophils Contribute to Spontaneous Resolution of Liver Inflammation and Fibrosis via MicroRNA-223. J. Clin. Investig. 2019, 129, 4091–4109. [Google Scholar] [CrossRef]
- Thapa, M.; Chinnadurai, R.; Velazquez, V.M.; Tedesco, D.; Elrod, E.; Han, J.; Sharma, P.; Ibegbu, C.; Gewirtz, A.; Anania, F.; et al. Liver Fibrosis Occurs through Dysregulation of MyD88-dependent Innate B-cell Activity. Hepatology 2015, 61, 2067–2079. [Google Scholar] [CrossRef] [PubMed]
- Barrow, F.; Khan, S.; Fredrickson, G.; Wang, H.; Dietsche, K.; Parthiban, P.; Robert, S.; Kaiser, T.; Winer, S.; Herman, A.; et al. Microbiota-Driven Activation of Intrahepatic B Cells Aggravates NASH Through Innate and Adaptive Signaling. Hepatology 2021, 74, 704–722. [Google Scholar] [CrossRef] [PubMed]
- Karl, M.; Hasselwander, S.; Zhou, Y.; Reifenberg, G.; Kim, Y.O.; Park, K.; Ridder, D.A.; Wang, X.; Seidel, E.; Hövelmeyer, N.; et al. Dual Roles of B Lymphocytes in Mouse Models of Diet-induced Nonalcoholic Fatty Liver Disease. Hepatology 2022, 76, 1135–1149. [Google Scholar] [CrossRef] [PubMed]
- Cassiman, D.; Libbrecht, L.; Desmet, V.; Denef, C.; Roskams, T. Hepatic Stellate Cell/Myofibroblast Subpopulations in Fibrotic Human and Rat Livers. J. Hepatol. 2002, 36, 200–209. [Google Scholar] [CrossRef] [PubMed]
- Huby, T.; Gautier, E.L. Immune Cell-Mediated Features of Non-Alcoholic Steatohepatitis. Nat. Rev. Immunol. 2022, 22, 429–443. [Google Scholar] [CrossRef]
- Rinella, M.E.; Elias, M.S.; Smolak, R.R.; Fu, T.; Borensztajn, J.; Green, R.M. Mechanisms of Hepatic Steatosis in Mice Fed a Lipogenic Methionine Choline-Deficient Diet. J. Lipid Res. 2008, 49, 1068–1076. [Google Scholar] [CrossRef]
- Sanders, F.W.B.; Griffin, J.L. De Novo Lipogenesis in the Liver in Health and Disease: More than Just a Shunting Yard for Glucose. Biol. Rev. 2016, 91, 452–468. [Google Scholar] [CrossRef]
- Batchuluun, B.; Pinkosky, S.L.; Steinberg, G.R. Lipogenesis Inhibitors: Therapeutic Opportunities and Challenges. Nat. Rev. Drug Discov. 2022, 21, 283–305. [Google Scholar] [CrossRef]
- Wang, Q.; Liu, S.; Zhai, A.; Zhang, B.; Tian, G. AMPK-Mediated Regulation of Lipid Metabolism by Phosphorylation. Biol. Pharm. Bull. 2018, 41, 985–993. [Google Scholar] [CrossRef]
- Scarpulla, R.C. Metabolic Control of Mitochondrial Biogenesis through the PGC-1 Family Regulatory Network. Biochim. Biophys. Acta (BBA)-Mol. Cell Res. 2011, 1813, 1269–1278. [Google Scholar] [CrossRef]
- Liu, L.; Li, Y.; Wang, J.; Zhang, D.; Wu, H.; Li, W.; Wei, H.; Ta, N.; Fan, Y.; Liu, Y.; et al. Mitophagy Receptor FUNDC1 Is Regulated by PGC-1α/NRF1 to Fine Tune Mitochondrial Homeostasis. EMBO Rep. 2021, 22, e50629. [Google Scholar] [CrossRef] [PubMed]
- Piccinin, E.; Villani, G.; Moschetta, A. Metabolic Aspects in NAFLD, NASH and Hepatocellular Carcinoma: The Role of PGC1 Coactivators. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 160–174. [Google Scholar] [CrossRef] [PubMed]
- Douiev, L.; Miller, C.; Ruppo, S.; Benyamini, H.; Abu-Libdeh, B.; Saada, A. Upregulation of COX4-2 via HIF-1α in Mitochondrial COX4-1 Deficiency. Cells 2021, 10, 452. [Google Scholar] [CrossRef] [PubMed]
- Schuppan, D.; Surabattula, R.; Wang, X.Y. Determinants of Fibrosis Progression and Regression in NASH. J. Hepatol. 2018, 68, 238–250. [Google Scholar] [CrossRef]
- Decaris, M.L.; Li, K.W.; Emson, C.L.; Gatmaitan, M.; Liu, S.; Wang, Y.; Nyangau, E.; Colangelo, M.; Angel, T.E.; Beysen, C.; et al. Identifying Nonalcoholic Fatty Liver Disease Patients with Active Fibrosis by Measuring Extracellular Matrix Remodeling Rates in Tissue and Blood. Hepatology 2017, 65, 78–88. [Google Scholar] [CrossRef]
- Zisser, A.; Ipsen, D.H.; Tveden-Nyborg, P. Hepatic Stellate Cell Activation and Inactivation in NASH-Fibrosis—Roles as Putative Treatment Targets? Biomedicines 2021, 9, 365. [Google Scholar] [CrossRef]
- Jarrar, M.H.; Baranova, A.; Collantes, R.; Ranard, B.; Stepanova, M.; Bennett, C.; Fang, Y.; Elariny, H.; Goodman, Z.; Chandhoke, V.; et al. Adipokines and Cytokines in Non-alcoholic Fatty Liver Disease. Aliment. Pharmacol. Ther. 2008, 27, 412–421. [Google Scholar] [CrossRef]
- de Lalla, C.; Galli, G.; Aldrighetti, L.; Romeo, R.; Mariani, M.; Monno, A.; Nuti, S.; Colombo, M.; Callea, F.; Porcelli, S.A.; et al. Production of Profibrotic Cytokines by Invariant NKT Cells Characterizes Cirrhosis Progression in Chronic Viral Hepatitis. J. Immunol. 2004, 173, 1417–1425. [Google Scholar] [CrossRef]
- Park, O.; Jeong, W.-I.; Wang, L.; Wang, H.; Lian, Z.-X.; Gershwin, E.M.; Gao, B. Diverse Roles of Invariant Natural Killer T Cells in Liver Injury and Fibrosis Induced by Carbon Tetrachloride. Hepatology 2009, 49, 1683–1694. [Google Scholar] [CrossRef]
- Koda, Y.; Teratani, T.; Chu, P.-S.; Hagihara, Y.; Mikami, Y.; Harada, Y.; Tsujikawa, H.; Miyamoto, K.; Suzuki, T.; Taniki, N.; et al. CD8+ Tissue-Resident Memory T Cells Promote Liver Fibrosis Resolution by Inducing Apoptosis of Hepatic Stellate Cells. Nat. Commun. 2021, 12, 4474. [Google Scholar] [CrossRef]
- Csak, T.; Ganz, M.; Pespisa, J.; Kodys, K.; Dolganiuc, A.; Szabo, G. Fatty Acid and Endotoxin Activate Inflammasomes in Mouse Hepatocytes That Release Danger Signals to Stimulate Immune Cells. Hepatology 2011, 54, 133–144. [Google Scholar] [CrossRef] [PubMed]
- Cancello, R.; Tordjman, J.; Poitou, C.; Guilhem, G.; Bouillot, J.L.; Hugol, D.; Coussieu, C.; Basdevant, A.; Hen, A.B.; Bedossa, P.; et al. Increased Infiltration of Macrophages in Omental Adipose Tissue Is Associated with Marked Hepatic Lesions in Morbid Human Obesity. Diabetes 2006, 55, 1554–1561. [Google Scholar] [CrossRef] [PubMed]
- Nagaya, T.; Tanaka, N.; Suzuki, T.; Sano, K.; Horiuchi, A.; Komatsu, M.; Nakajima, T.; Nishizawa, T.; Joshita, S.; Umemura, T.; et al. Down-Regulation of SREBP-1c Is Associated with the Development of Burned-out NASH. J. Hepatol. 2010, 53, 724–731. [Google Scholar] [CrossRef] [PubMed]
- Kawamura, S.; Matsushita, Y.; Kurosaki, S.; Tange, M.; Fujiwara, N.; Hayata, Y.; Hayakawa, Y.; Suzuki, N.; Hata, M.; Tsuboi, M.; et al. Inhibiting SCAP/SREBP Exacerbates Liver Injury and Carcinogenesis in Murine Nonalcoholic Steatohepatitis. J. Clin. Investig. 2022, 132, e151895. [Google Scholar] [CrossRef] [PubMed]
- Lambert, J.E.; Ramos–Roman, M.A.; Browning, J.D.; Parks, E.J. Increased De Novo Lipogenesis Is a Distinct Characteristic of Individuals with Nonalcoholic Fatty Liver Disease. Gastroenterology 2014, 146, 726–735. [Google Scholar] [CrossRef]
- Teratani, T.; Tomita, K.; Suzuki, T.; Oshikawa, T.; Yokoyama, H.; Shimamura, K.; Tominaga, S.; Hiroi, S.; Irie, R.; Okada, Y.; et al. A High-Cholesterol Diet Exacerbates Liver Fibrosis in Mice via Accumulation of Free Cholesterol in Hepatic Stellate Cells. Gastroenterology 2012, 142, 152–164.e10. [Google Scholar] [CrossRef]
- Youle, R.J.; Narendra, D.P. Mechanisms of Mitophagy. Nat. Rev. Mol. Cell. Biol. 2011, 12, 9–14. [Google Scholar] [CrossRef]
- Moore, M.P.; Cunningham, R.P.; Meers, G.M.; Johnson, S.A.; Wheeler, A.A.; Ganga, R.R.; Spencer, N.M.; Pitt, J.B.; Diaz-Arias, A.; Swi, A.I.A.; et al. Compromised Hepatic Mitochondrial Fatty Acid Oxidation and Reduced Markers of Mitochondrial Turnover in Human NAFLD. Hepatology 2022, 76, 1452–1465. [Google Scholar] [CrossRef]
- Finck, B.N. PGC-1 Coactivators: Inducible Regulators of Energy Metabolism in Health and Disease. J. Clin. Investig. 2006, 116, 615–622. [Google Scholar] [CrossRef]
Nutrition Facts | MASH Diet: OYC-NASH1 |
---|---|
Moisture | 9.0% |
Crude protein | 17.2% |
Crude fat | 28.2% |
Coarse ash content | 3.0% |
Coarse fiber | 4.7% |
Nitrogen free extract | 38.0% |
Calories | 474.2 kcal/100 g of the diet |
Saturated fatty acid | 34.4% of total fatty acid |
Monounsaturated fatty acid | 29.3% of total fatty acid |
Polyunsaturated fatty acid | 36.2% of total fatty acid |
Methionine | 0.11% |
Choline | 0% |
Probe Name | Probe Sequence (5′ to 3′) |
---|---|
Col1a1-forward | GACGCATGGCCAAGAAGACA |
Col1a1-reverse | ATTGCACGTCATCGCACACA |
Acta2-forward | CTTCGCTGGTGATGATGCTC |
Acta2-reverse | GATGATGCCGTGTTCTATCG |
Tgfb1-forward | TATTTGGAGCCTGGACACAC |
Tgfb1-reverse | GTAGTAGACGATGGGCAGTGG |
Tnf-forward | AGCACAGAAAGCATGATCCG |
Tnf-reverse | GGAGGCCATTTGGGAACTTC |
Il6-forward | ACAAAGCCAGAGTCCTTCAGAG |
Il6-reverse | TTGGTCCTTAGCCACTCCTTC |
Il1b-forward | CCCTGCAGCTGGAGAGTGTGGA |
Il1b-reverse | TGTGCTCTGCTTGTGAGGTGCTG |
Ifng-forward | AGACAATCAGGCCATCAGCA |
Ifng-reverse | TGGACCTGTGGGTTGTTGAC |
Pck2-forward | ATGGCTGCTATGTACCTCCC |
Pck2-reverse | GCGCCACAAAGTCTCGAAC |
Pdk4-forward | AGGGAGGTCGAGCTGTTCTC |
Pdk4-reverse | GGAGTGTTCACTAAGCGGTCA |
Plin2-forward | GACCTTGTGTCCTCCGCTTAT |
Plin2-reverse | CAACCGCAATTTGTGGCTC |
Cox4i1-forward | GTACCGCATCCAGTTTAACGA |
Cox4i1-reverse | TGGGGCCATACACATAGCTCT |
Cox4i2-forward | CTGCCCGGAGTCTGGTAATG |
Cox4i2-reverse | CAGTCAACGTAGGGGGTCATC |
Hprt-forward | CGCAGTCCCAGCGTCGTGATT |
Hprt-reverse | CTTGAGCACACAGAGGGCCACAA |
Time After Feeding | ||||||||
---|---|---|---|---|---|---|---|---|
Variables | 0-Week | 1 Week | 2 Weeks | 4 Weeks | 8 Weeks | 12 Weeks | 24 Weeks | 48 Weeks |
TP (g/dL) | 5.0 ± 0.2 | 4.6 ± 0.1 | 4.7 ± 0.1 | 5.0 ± 0.1 | 4.6 ± 0.1 | 4.9 ± 0.1 | 5.0 ± 0.1 | 5.2 ± 0.2 |
Alb (g/dL) | 3.2 ± 0.1 | 3.2 ± 0.1 | 3.2 ± 0.1 | 3.3 ± 0.0 | 3.0 ± 0.1 | 3.1 ± 0.0 | 3.1 ± 0.1 | 3.2 ± 0.1 |
A/G | 1.9 ± 0.0 | 2.2 ± 0.1 | 2.2 ± 0.1 | 2.0 ± 0.1 | 1.9 ± 0.1 | 1.7 ± 0.1 | 1.8 ± 0.2 | 1.6 ± 0.1 |
Fe (μg/dL) | 180.3 ± 23.1 | 199.0 ± 7.9 | 178.3 ± 7.3 | 182.3 ± 4.8 | 160.3 ± 9.4 | 176.7 ± 2.2 | 166.7 ± 23.5 | 159.7 ± 7.0 |
Total Cho (mg/dL) | 89.0 ± 2.9 | 59.0 ± 3.2 a | 57.3 ± 3.8 a | 65.0 ± 1.2 | 66.7 ± 5.5 | 77.0 ± 10.1 | 91.7 ± 1.7 | 118.7 ± 11.3 a |
Free Cho (mg/dL) | 14.7 ± 2.3 | 19.0 ± 1.2 | 20.3 ± 1.5 | 22.7 ± 1.8 | 20.3 ± 2.3 | 21.3 ± 2.3 | 27.3 ± 1.8 b | 31.7 ± 2.4 d |
Esterified Cho (mg/dL) | 75.0 ± 1.5 | 40.0 ± 3.8 c | 37.0 ± 2.5 c | 42.3 ± 1.8 b | 46.3 ± 3.4 b | 55.7 ± 7.8 | 64.3 ± 2.2 | 87.0 ± 9.0 |
E/T (%) | 82.3 ± 0.9 | 67.7 ± 3.3 c | 64.3 ± 0.9 d | 65.0 ± 2.5 d | 69.7 ± 1.2 c | 72.0 ± 0.6 b | 70.3 ± 1.8 b | 73.3 ± 0.9 a |
TG (mg/dL) | 77.3 ± 2.2 | 25.3 ± 0.9 a | 35.7 ± 6.9 | 77.3 ± 27.0 | 56.0 ± 10.5 | 35.0 ± 6.8 | 52.7 ± 2.2 | 30.3 ± 3.8 a |
NEFA (μEq/L) | 816.3 ± 23.9 | 805.0 ± 38.2 | 1100.3 ± 170.5 | 852.3 ± 148.9 | 1108.3 ± 61.4 | 653.7 ± 65.3 | 945.3 ± 203.1 | 733.7 ± 79.5 |
LDL Cho (mg/dL) | 6.3 ± 0.3 | 1.0 ± 0.0 b | 1.0 ± 0.0 b | 1.0 ± 0.0 b | 1.3 ± 0.3 b | 1.7 ± 0.3 b | 4.7 ± 0.9 | 7.0 ± 2.1 |
HDL Cho (mg/dL) | 61.0 ± 1.7 | 33.7 ± 4.1 c | 32.0 ± 2.5 c | 34.7 ± 1.2 c | 35.0 ± 1.2 c | 43.0 ± 5.5 a | 38.7 ± 2.8 b | 63.0 ± 6.2 |
TKB (μmol/L) | 117.0 ± 6.9 | 639.3 ± 273.9 a | 229.7 ± 40.9 | 236.0 ± 47.5 | 370.3 ± 136.5 | 318.7 ± 77.5 | 2098.3 ± 107.3 d | 232.3 ± 45.7 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sakaguchi, T.; Nagahama, Y.; Hamada, N.; Singh, S.K.; Mikami, H.; Maeda, K.; Akira, S. Novel Choline-Deficient and 0.1%-Methionine-Added High-Fat Diet Induces Burned-Out Metabolic-Dysfunction-Associated Steatohepatitis with Inflammation by Rapid Immune Cell Infiltration on Male Mice. Nutrients 2024, 16, 4151. https://doi.org/10.3390/nu16234151
Sakaguchi T, Nagahama Y, Hamada N, Singh SK, Mikami H, Maeda K, Akira S. Novel Choline-Deficient and 0.1%-Methionine-Added High-Fat Diet Induces Burned-Out Metabolic-Dysfunction-Associated Steatohepatitis with Inflammation by Rapid Immune Cell Infiltration on Male Mice. Nutrients. 2024; 16(23):4151. https://doi.org/10.3390/nu16234151
Chicago/Turabian StyleSakaguchi, Takatoshi, Yasuharu Nagahama, Nanako Hamada, Shailendra Kumar Singh, Hayato Mikami, Kazuhiko Maeda, and Shizuo Akira. 2024. "Novel Choline-Deficient and 0.1%-Methionine-Added High-Fat Diet Induces Burned-Out Metabolic-Dysfunction-Associated Steatohepatitis with Inflammation by Rapid Immune Cell Infiltration on Male Mice" Nutrients 16, no. 23: 4151. https://doi.org/10.3390/nu16234151
APA StyleSakaguchi, T., Nagahama, Y., Hamada, N., Singh, S. K., Mikami, H., Maeda, K., & Akira, S. (2024). Novel Choline-Deficient and 0.1%-Methionine-Added High-Fat Diet Induces Burned-Out Metabolic-Dysfunction-Associated Steatohepatitis with Inflammation by Rapid Immune Cell Infiltration on Male Mice. Nutrients, 16(23), 4151. https://doi.org/10.3390/nu16234151