Next Article in Journal
Impact of Pre-Existing Uterine Microbiome on Pregnancy Success After Embryo Transfer in Cattle
Previous Article in Journal
Detection and Host Range Investigation of Phytopythium helicoides and Phytopythium palingenes
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Microbiology Research
Volume 17
Issue 5
10.3390/microbiolres17050089
microbiolres-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Enterococcus durans Secretome Modulates Interleukins Gene Expressions in Intestinal Epithelial Cells Challenged by Staphylococcus aureus Secretome: In Vitro Study on the HT-29 Cell Line

by
Egidia Costanzi
1,
Giovanna Traina
2,
Marco Misuraca
1,
Donia Msakni
1,
Giada Sgaravizzi
2,
Musafiri Karama
3,
Ebtesam Al-Olayan
4,
Saeed El-Ashram
5,
Marcelo Martinez-Barbitta
6,
Massimo Zerani
1,* and
Beniamino T. Cenci-Goga
1,3,*
1
Dipartimento di Medicina Veterinaria, Università di Perugia, 06121 Perugia, Italy
2
Dipartimento di Scienze Farmaceutiche, Università di Perugia, 06121 Perugia, Italy
3
Department of Paraclinical Sciences, Faculty of Veterinary Science, University of Pretoria, Onderstepoort 0110, South Africa
4
Department of Zoology, College of Science King Saud University, Riyadh P.O. Box 2454, Saudi Arabia
5
Zoology Department, Faculty of Science, Kafrelsheikh University, Kafr El-Sheikh 33516, Egypt
6
Sistema Reproductivo Veterinario Integral Uruguay, SRVI_UY, Nueva Helvecia 70300, Uruguay
*
Authors to whom correspondence should be addressed.
Microbiol. Res. 2026, 17(5), 89; https://doi.org/10.3390/microbiolres17050089 (registering DOI)
Submission received: 11 March 2026 / Revised: 20 April 2026 / Accepted: 29 April 2026 / Published: 30 April 2026
(This article belongs to the Special Issue Cell Culture Advances in Food Microbiology: Innovative In Vitro Models for Safety, Quality, and Functionality)
Browse Figures
Review Reports Versions Notes

Abstract

The present study examined the effect of Enterococcus durans cell-free supernatant (CFS) on interleukin (IL)-8, -10 and -1β gene expressions in the intestinal cell line HT-29 treated with Staphylococcus aureus CFS. HT-29 cells were incubated with E. durans CFS or S. aureus CFS, or S. aureus CFS plus E. durans CFS. All concentrations of E. durans CFS did not show cytotoxicity, while the highest treatment (44.9 μg/mL) with S. aureus CFS induced significant cell death. S. aureus CFS did not modify IL-1β gene expression, while E. durans CFS alone or in combination with S. aureus CFS reduced it. Treatment with S. aureus CFS induced greater expression of the IL-8 gene compared to S. aureus CFS plus E. durans CFS. S. aureus CFS alone or in combination with E. durans CFS increased the expression of the IL-10 gene, while E. durans CFS alone did not modify it. These results suggest a potential protective role of the E. durans secretome in mitigating the inflammatory environment in intestinal cells. This treatment could be useful to protect against possible contact with dangerous soluble microbial products present in food.

1. Introduction

One of the most recurring and current public health issues is gastrointestinal tract disease. Frequently, many pathological processes are accompanied by an inflammatory intestinal state, such as inflammatory bowel disease or simply irritable bowel syndrome, in which cells of different natures are involved. In the intestinal ecosystem, the microbiota plays an essential role in both digestive processes and in the production of active components that contribute to human health [1].
Food composition influences the intestinal microbiota [1], so its safety must be ensured to prevent the introduction of harmful pathogens and/or their products. To prevent this, attention needs to be paid to (i) pathogenic bacteria in raw materials, (ii) microorganisms used as starter cultures, or (iii) any other bacterial contamination during food processing. Staphylococcus aureus is responsible for clinical syndromes associated with the production of toxic molecules [2], e.g., virulence factors and secondary metabolites such as bacteriocins, signaling molecules or metallophores, the latter being secondary metabolites that enable bacteria to sequester metal ions from the surrounding environment since the availability of metal ions is crucial for bacterial metabolism and virulence [3]. Most of these molecules are not destroyed by acids, proteases, or heat treatments, remaining biologically active during food processing [4,5,6]. Contaminated or inefficiently processed foods can generate a highly variable spectrum of diseases [7,8], resulting in serious public health and economic damage. Natural defenses against foodborne pathogens and their products include cytokines and chemokines, which can communicate with neighboring inflammatory cells and the immune mucosa cell system [9]. S. aureus enterotoxins, under particular conditions, could induce the expression of pro-inflammatory cytokines [10,11]. Interleukin-8 (IL-8) is a neutrophil chemoattractant [12,13], which amplifies the acute immune response of macrophages and neutrophils, and it is expressed and secreted by epithelial cells [14]. S. aureus, through the toll-like receptor 2, triggers the signaling cascade for inflammatory responses in which IL-8 is involved [14].
The intestinal epithelial tight junction (TJ) barrier controls the paracellular permeation of contents from the intestinal lumen into the intestinal tissue and systemic circulation [15,16]. IL-1β, a pivotal cytokine which governs inflammatory responses, increases this TJ permeability, contributing to the intestinal inflammatory process [15]. In addition, Il-1β production can exacerbate tissue damage and worsen clinical outcomes in invasive infections, such as pneumonia bacteremia [17,18]; interestingly, some studies suggested that S. aureus can exploit IL-1β to favor its own survival and proliferation, highlighting the complex interplay between this pathogen and host inflammatory pathways [19,20].
S. aureus has been shown to manipulate host immunoregulatory mechanisms to facilitate persistence during infection and IL-10 appears to be at the forefront of this evasion strategy [21]. Intestinal epithelial cells also secrete IL-10 and its expression can be modulated by commensal microorganisms, although the ability to stimulate cells to produce mediators is related to bacterial species and/or directly to specific strains [22,23]. Lactic acid bacteria (LAB) are commensal microorganisms of the gastrointestinal tract that can be introduced from the diet. Enterococcus spp. is an ancient genus of LAB that represents normal intestinal commensals and plays an important role in maintaining intestinal homeostasis through continuous immune system activities [24]. Among Enterococcaceae, the strain of E. durans is widely found in the production of cheese and yogurt, showing antimicrobial properties [25] and probiotic characteristics [26,27,28].
Beyond live probiotics, interest is growing in probiotic-driven metabolites, known as ‘postbiotics’, soluble factors such as products or metabolic by-products released in the medium by living and growing bacteria [29]. They include organic acids, short-chain fatty acids, peptides and proteins, enzymes, cofactors, and immune-modulating compounds, as well as different components of bacterial lysis [30,31] that could represent bioactive components involved in a beneficial effect against some intestinal disorders [32]. Therefore, postbiotics are considered a good alternative to live bacteria with some beneficial effects on gut microbiota homeostasis, offering advantages compared with the corresponding live probiotics—such as stability, resistance to environmental stress, and an improved safety profile, as they do not harbor transferable antibiotic resistance genes, whose spread in the environment has been clearly demonstrated [33,34,35,36].
The secretome is defined as the set of molecules and biological factors that cells release, also by vesicles, into the extracellular space [37], in in vitro cultured bacteria it corresponds to the soluble components naturally released in the medium (cell-free supernatant, CFS) [38]. Numerous studies have analyzed the impact of metabolic compounds derived from probiotic fermentation on hazardous microorganisms or systems under dysbiosis conditions. The secretome of a Gram-positive bacterium can be easily extracted from growth medium and separated from other cellular contaminants [39]. The secretome of various intestinal bacteria was shown to exert strong antibacterial activity against Escherichia coli, Candida albicans, and Clostridium perfringens infection [40,41,42]. These activities are dependent on concentration and strain and are also influenced by the experimental conditions of the models used [8,43].
Enterococci strains were frequently isolated from fermented food, where they contributed to the ripening and aroma development of certain cheeses or fermented sausages [44], these bacteria are nevertheless involved in probiotic activities [45]. Therefore, even though there is no extensive research on the immunomodulatory properties of Enterococcus spp., some strains are receiving increasing interest [46,47].
The HT-29 cell line is an in vitro model that is used to simulate cellular responses, making it suitable for the study of inflammatory signaling [48]. These cells are characterized by multiple functions of their normal counterparts, such as the expression of a constitutive common pattern of cytokines [8]. Ohtsuki et al. [49] reported that in vitro liposaccharides increased IL-8 secretion from HT-29, while the curative secretome derived from human amniotic mesenchymal stromal cells decreased IL-8 production by HT-29 [50].
The aim of this study was to investigate the potential of the secretome of an E. durans strain isolated from dairy products to modulate the inflammatory response induced by the secretome of S. aureus in intestinal epithelial cells. In particular, we evaluated the in vitro effects of E. durans CFS on gene expressions of IL-8, -1β and -10 in the HT-29 cell line pretreated with S. aureus CFS. These interleukins were selected because they represent complementary markers of intestinal epithelial response, namely a pro-inflammatory chemokine involved in acute inflammatory signaling, a cytokine associated with epithelial barrier dysfunction, and a key immunoregulatory mediator, respectively. Taken together, this panel was considered appropriate to evaluate the potential immunomodulatory activity of the E. durans secretome in an HT-29 Sa-CFS-induced-inflammatory model.

2. Materials and Methods

2.1. Bacterial Isolation and Identification

The bacteria strains were from the collection of our laboratory and classified as E. durans (internal reference #79) [5] and S. aureus (ATCC 29213, internal reference #239) [4].
Before the test, freeze-dried E. durans (internal reference #79) was grown in Tryptic Soy Broth (TSB, BD Difco, Franklin Lakes, NJ, USA) at 37 °C for 48 h in air and then spread on mENTagar (mENT, BD Difco) at 37 °C for 48 h to verify purity. Instead, S. aureus was grown in Mueller Hinton broth (MH, BD Difco, Franklin Lakes, NJ, USA) at 37 °C for 48 h on air and then spread on Baird Parker agar (BP, BD Difco) at 37 °C for 48 h to check for purity. After incubation, the concentration for all strains was approximately 1 × 109 cfu/mL.
All microorganisms used in this study were kept as stocks in a freeze-dried state (−80 °C containing 10% DMSO) until use.

2.2. Bacterial Cell-Free Supernatant Preparation

E. durans was incubated for 24 h at 37 °C in MRS broth (de Man, Rogosa, Sharpe medium, Oxoid, Hampshire, UK) and grown to a stationary phase. S. aureus was grown in brain heart infusion broth (BHI, Oxoid) at 37 °C to a concentration of 108–109 cfu/mL.
Bacterial cells were removed by centrifugation (4000× g, 15′ at 4 °C). Each supernatant was then filtered to sterilize and remove any bacteria using a 0.22 mm pore size filter (Millipore, Burlington, MA, USA). To ensure that the filtrates were bacteria-free, we tested the E. durans cell-free supernatant (Ed-CFS) and the S. aureus cell-free supernatant (Sa-CFS), previously introduced as secretome, on plates with the relative culture medium. CFSs were kept at −80 °C until use.
The protein content of different bacterial CFS samples was determined by a Biorad assay (Biorad Laboratories Inc., Hercules, CA, USA) based on a standard curve performed by using BSA solutions (Sigma-Aldrich, St. Louis, MO, USA) under the same experimental conditions.
The bacterial CFS used for the experiments was diluted to optimal protein concentrations in the cell culture medium.

2.3. Cell Cultures

The human epithelial colorectal adenocarcinoma cell line HT-29 was obtained from the American Type Culture Collection (ATCC) (Manassas, VA, USA). They derived from adenocarcinoma, showing characteristics of human large intestine colonocytes.
HT-29 are cultured in supplemented RPMI (Roswell Park Memorial Institute) 1640 (Microtech. S.R.L. Europe, Naples, Italy) with 10% fetal bovine serum (FBS) (GIBCO Burlington, ON, Canada, BRL), 100 U/mL penicillin, 100 mg/mL of streptomycin, and 1% glutamine obtained from Sigma Chemical. Cells were kept at 37 °C in a 5% CO2 humidified incubator. The medium was changed every 3–4 days. The cells grew to 80% of confluence. Then they were detached from the flask using 0.05% trypsin–0.1% EDTA solution from MICROGEM (Microtech. S.R.L. Europe, Naples, Italy) and after washing, the cellular pellets were resuspended in a relative supplemented medium. Cells were counted by the Trypan Blue assay on the automated cell counter Countess 3 instrument (ThermoFisher Scientific, Wilmington, DE, USA) to seed a suitable number of cells for further experiments.

2.4. Determination of Enterococcus durans and Staphylococcus aureus CFSs Cytotoxicity in HT-29 Cells

A range of protein concentrations for each secretome was established using serial two-fold dilutions of the basal CFS (from 1:2 to 1:32 dilution range) in cell medium.
The protein content recovered from the medium depended on the bacterial concentration and the growth conditions used in the experiments. The growth of the E. durans strain was up to 108 cfu/mL and produced 123 μg/mL protein, (dilution from 61.5 to 3.8 μg/mL). S. aureus, cultured up to 1 × 108 cfu/mL, produced 89.9 μg/mL protein (dilution from 49.9 to 2.8 μg/mL).
Briefly HT-29 cells were seeded in 96-well plates (104 cells/well) and incubated in RPMI supplemented (10% fetal bovine serum, 100 U/mL penicillin, 100 mg/mL streptomycin and 1% glutamine) for 48 h until 80–85% of confluence. After removing the medium, cells were treated with Ed-CFS or Sa-CFS, appropriately filtered and diluted in cell medium for 24 h.
Following bacterial CFS treatments, the viability was determined as reported by the manufacturer’s instructions of the MTT-based in vitro toxicology assay kit (Sigma-Aldrich).
The highest non-cytotoxic protein concentration of the tested CSFs (Ed-CFS = 61.5 μg/mL, Sa-CFS = 22.45 μg/mL) (Figure 1) were used for all subsequent experiments.

2.5. HT-29 Cells Treatments

HT-29 cells were detached from T75 cm2 tissue culture flasks (NuncTM EasYFlaskTM Cell Culture Flasks, Thermo Fisher Scientific, Waltham, MA, USA), counted, resuspended in complete culture medium, seeded at a concentration of 5 × 105 cells/mL/well, and used for the following four experimental groups:
(a)
Incubation of HT-29 cells (2 h) with culture medium only (Control);
(b)
Incubation of HT-29 cells (2 h) with culture medium plus Ed-CFS (61.5 μg/mL protein);
(c)
Incubation of HT-29 cells (2 h) with culture medium plus Sa-CFS (22.45 μg/mL protein);
(d)
Incubation of HT-29 cells (2 h) with culture medium plus Sa-CFS (22.45 μg/mL protein) followed by the addition of Ed-CFS (61.5 μg/mL protein), further 2 h of incubation.
This latter experimental group was used to determine the effects of Ed-CFS in cells that have previously been challenged by Sa-CFS.
The 2 h exposure time was chosen to investigate early transcriptional responses in HT-29 cells while minimizing confounding effects related to prolonged incubation.

2.6. Interleukin-8, -10, and -1β Gene Expression

Total RNA from HT-29 cells from each well was extracted using TRI reagent solution from Ambion (Applied Biosystem, Carlsbad, CA, USA) according to the manufacturer’s instructions. RNA concentration and purity (OD260/OD280 absorption ratio > 1.9) was assessed by spectrophotometry analysis determined using a NanoDropTM (ThermoFisher Scientific). Total RNA (1 μg of each sample) was then reverse transcribed into cDNA using High-Capacity cDNA reverse transcription kit (ThermoFisher Scientific). Finally, quantitative real-time PCR (qRT-PCR) was performed with the SYBR Green method using the PowerUp SYBR Green Master Mix (ThermoFisher Scientific).
The primer sequences used for the analysis of the genes IL-8, IL-10, IL-1β, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) are listed in Table 1. GAPDH represented the housekeeping gene. It was used as an internal control for the normalization of gene expression. The specificity of each primer pair was verified by the presence of a single melting temperature peak. The reactions were performed in a Bio-Rad i-Cycler thermal cycler and conducted in triplicate.
The level of mRNA expression of each gene was analyzed according to the Ct values of the target genes and the endogenous control (GAPDH) of each experiment and calculated using the 2−ΔΔCt method.

2.7. Statistical Analysis

Statistical analyses were performed using GraphPad Prism (version 8.4.3 for Mac OS). Differences among groups were evaluated by one-way ANOVA followed by Tukey’s multiple comparison test. Data are expressed as mean ± SD of three independent experiments, each performed in quadruplicate, unless otherwise stated. For all tests, a two-tailed significance level of p < 0.05 was considered statistically significant.

3. Results

3.1. Cytotoxicity of Enterococcus durans and Staphylococcus aureus in HT-29 Cells

None of the used E. durans CFS concentrations induced significant cytotoxic effects in HT-29 cells (Figure 1a).
The highest S. aureus CFS concentration (44.9 μg/mL) induced significant (p < 0.05) cell death (48.8%) (Figure 1b).

3.2. Effect of Enterococcus durans and Staphylococcus aureus CFS on HT-29 Interleukin-8, -10, and -1β Gene Expression

Interleukin-8. Treatments with Ed-CFS and Sa-CFS alone or in combination did not modify IL-8 gene expression compared to the control (Figure 2a). The expression of the IL-8 gene was higher (p < 0.05) in Sa-CFS alone than in Sa-CFS plus Ed-CFS (Figure 2a).
Interleukin-1β. Treatments with Sa-CFS alone did not modify IL-1β gene expression compared to control (Figure 2b), whereas Ed-CFS alone or in combination with Sa-CFS reduced (p < 0.05) this gene expression (Figure 2b). IL-1β gene expression was higher (p < 0.05) in Sa-CFS alone than in Ed-CFS alone or in Sa-CFS plus Ed-CFS (Figure 2b).
Interleukin-10. Ed-CFS treatments did not modify IL-10 gene expression compared to the control, while Sa-CFS alone (p < 0.05) or Sa-CFS plus Ed-CFS (p < 0.05) increased this gene expression (Figure 2c), this increase was greater (p < 0.05) in Sa-CFS alone than in Sa-CFS plus Ed-CFS (Figure 2c). IL-10 gene expression was higher (p < 0.05) in Sa-CFS alone and in Sa-CFS plus Ed-CFS than in Ed-CFS alone (Figure 2c).

4. Discussion

The present study suggests that the E. durans secretome represents an agent potentially reducing the inflammatory state of the intestinal epithelium, particularly the one induced in the HT-29 intestinal cell line by the S. aureus secretome. The E. durans strain used in this study, isolated from Umbrian dairy production, was selected based on its presumed safety, as strains originating from fermented foods are generally considered safe and have been extensively characterized [5]; this is supported by our results showing no cytotoxic effects on HT-29 cells This study confirmed this as it was non-cytotoxic to HT-29 cells. This strain of dairy origin was previously selected as starter cultures for fermented products based also on its technological performance: the relevance of the present findings to human health should be interpreted in relation to their potential contribution to food safety and probiotic activity [5].
Treatment with the E. durans secretome for 24 h did not show cytotoxic effects in HT-29 epithelial cells, demonstrating that all secreted products were not hazardous. Viability was always maintained at each concentration of the CFS protein used and was greater than 90% in HT-29 compared to control cells.
These data are consistent with a previously published study on the safe in vitro use of enterococci secretome in Caco-2 cells [51]. On the contrary, the present data reported that 24 h administration of the S. aureus secretome (45 μg/mL) has induced significant cell death in HT-29 cells, up to 47%. Regarding the effects on IL-8 gene expression, all Ed-CFS and Sa-CFS added alone or in combination maintained the same level of gene expression of control cells, demonstrating that there was no induction of this interleukin in colonocytes and confirms previous data in Caco-2 cells [52]. Despite this, interestingly, our results show a significant difference in gene activity between treatments with Sa-CFS alone (higher levels) and those with Sa-CFS plus Ed-CFS (lower levels); this could suggest an inhibitory effect of the secretome of E. durans on the activity of the IL-8 gene affected by S. aureus.
Daig et al. [53] and more recently Ichikawa et al. [54] reported that IL-8 expression is very low in normal tissue and is tightly regulated; in particular, HT-29 cells show a low level of constitutive IL-8 secretion [55]. McCracken et al. [56] showed that IL-8 was not detectable in HT-29 cells and that it was not altered after coculture with Lactobacillus planctarum. In this context, Ma et al. [55] reported that IL-8 synthesis did not increase when intestinal epithelial cells HT-29 and Caco-2 were stimulated with L. reuteri.
Subsequently, Jeffrey et al. [57] demonstrated that exposure of host epithelial cells to L. rhamnosus and L. helveticus, without any innate immune stimulants, did not induce alteration in constitutive IL-8 production of IL-8 in HT-29 cells. In our study, the significant difference between the experimental groups of Sa-CFS and Sa-CFS plus Ed-CFS appears to suggest that the secretome of E. durans affects IL-8 secretion only after Sa-CFS exerted its effects.
Intestinal epithelial cells of the mucosa do not produce a significant amount of IL-1β under physiological conditions IL-1β [53]. In our experimental model, we found that its basal gene expression was significantly reduced by the secretome of E. durans, both alone and in combination with those of S. aureus. The latter alone, in turn, did not show an effect on IL-1β gene expression, suggesting that the two secretomes do not interact in the regulation of IL-1β.
The most intriguing data from the study concern IL-10 gene expression: the administration of Ed-CFS alone did not affect the level of gene expression; instead, this gene activity showed a massive and significant increase after the administration of Sa-CFS alone, which was reduced, but not canceled, with subsequent treatment with Ed-CFS; in fact, the value of mRNA decreased significantly compared to Sa-CFS alone, but remained significantly higher than the baseline value. There is extensive literature on the capacity of S. aureus to evade host innate and adaptive immune responses [58,59,60,61], and the fact that the production of IL-10 can facilitate bacterial persistence [62,63]. Recently, the increase in IL-10 gene transcription has been attributed to staphylococcal lactate [64]. Consistent with the above findings, we observed a significant increase in IL-10 gene expression in HT-29 cells in the presence of Sa CSF. This finding should be interpreted cautiously, as IL-10 plays a complex role in epithelial immune responses, acting not only as an anti-inflammatory cytokine but also as a regulator of immune homeostasis. Therefore, the increased IL-10 expression observed in response to S. aureus secreted factors, including food-related enterotoxins [65], may reflect a host counter-regulatory response to inflammatory stimulation rather than simply confirming the ability of the pathogen to suppress a hostile inflammatory environment. Moreover, our data suggest that this IL-10 response was markedly reduced in the presence of the E. durans secretome. As previously demonstrated, the decrease in IL-10 expression following supplementation with the E. durans secretome did not return to baseline levels, suggesting that the secretome may modulate, rather than completely abolish, the regulatory response induced by Sa CSF [66]. This pattern may indicate the persistence of a partial state of tolerance accompanied by maintained inflammatory alertness, although the biological significance of this balance remains to be further clarified [66].
Overall, the results of the present in vitro study indicate that the E. durans secretome is capable of influencing inflammatory responses in HT-29 cells. However, given the limitations inherent to the in vitro experimental model, these findings should be considered preliminary. Thus, although the data support the hypothesis that the E. durans strain may possess postbiotic-related properties, further studies in more complex and physiologically relevant systems are needed before any potential biological or practical applications can be inferred.

Author Contributions

Conceptualization: G.T., E.C., B.T.C.-G., M.Z.; methodology: E.C., S.E.-A., E.A.-O.; investigation: E.C., M.M., D.M., G.S.; formal analysis: B.T.C.-G.; validation: M.K., M.M.-B.; writing—original draft preparation: E.C.; writing—review and editing: M.Z.; supervision: B.T.C.-G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the (i) European Union—Next Generation EU under the Italian Ministry of University and Research National Innovation Ecosystem Grant ECS00000041—Vitality; (ii) CGB&ZM Officine Trust (Perugia, Italy) grant 003_2025; (iii) AgriBioPack, 101124794, PRIMA 2023, Section 2, Call Multi-Topics, Topic 2.3.1-2023 (RIA: 101124794) and by (iv) Research Funding program, (ORF-2026-111), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
CFScell-free supernatant
EdEnterococcus durans
GAPDHglyceraldehyde-3-phosphate dehydrogenase
ILinterleukin
LABlactic acid bacteria
MTT3-(4,5-dimethylthiazol-2-thiazolyl)-2.5-diphenyl-2H-tetrazolium bromide
PCRpolymerase chain reaction
SaStaphylococcus aureus

References

  1. Veldhoen, M.; Brucklacher-Waldert, V. Dietary influences on intestinal immunity. Nat. Rev. Immunol. 2012, 12, 696–708. [Google Scholar] [CrossRef]
  2. Lowy, F.D. Staphylococcus aureus Infections. N. Engl. J. Med. 1998, 339, 520–532. [Google Scholar] [CrossRef]
  3. Ghssein, G.; Ezzeddine, Z. The key element role of metallophores in the pathogenicity and virulence of Staphylococcus aureus: A review. Biology 2022, 11, 1525. [Google Scholar] [CrossRef]
  4. Cenci-Goga, B.T.; Karama, M.; Rossitto, P.V.; Morgante, R.A.; Cullor, J.S. Enterotoxin production by Staphylococcus aureus isolated from mastitic cows. J. Food Prot. 2003, 66, 1693–1696. [Google Scholar] [CrossRef] [PubMed]
  5. Grispoldi, L.; Karama, M.; El-Ashram, S.; Saraiva, C.; García-Díez, J.; Chalias, A.; Cenci-Goga, B. Evolution and antimicrobial resistance of enterococci isolated from Pecorino and goat cheese manufactured on-farm in an area facing constraints as per EU Regulation 1305/2013 in Umbria, Italy. Ital. J. Food Saf. 2022, 11, 10070. [Google Scholar] [CrossRef] [PubMed]
  6. Dinges, M.M.; Orwin, P.M.; Schlievert, P.M. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev. 2000, 13, 16–34. [Google Scholar] [CrossRef]
  7. Harrison, L.M.; Morris, J.A.; Bishop, L.A.; Lauder, R.M.; Taylor, C.A.M.; Telford, D.R. Detection of specific antibodies in cord blood, infant and maternal saliva and breast milk to staphylococcal toxins implicated in sudden infant death syndrome (SIDS). FEMS Immunol. Med. Microbiol. 2004, 42, 94–104. [Google Scholar] [CrossRef] [PubMed]
  8. di Vito, R.; di Mezza, A.; Conte, C.; Traina, G. The crosstalk between intestinal epithelial cells and mast cells is modulated by the probiotic supplementation in co-culture models. Int. J. Mol. Sci. 2023, 24, 4157. [Google Scholar] [CrossRef]
  9. Zhou, X.; Wu, Y.; Zhu, Z.; Lu, C.; Zhang, C.; Zeng, L.; Xie, F.; Zhang, L.; Zhou, F. Mucosal immune response in biology, disease prevention and treatment. Signal Transduct. Target. Ther. 2025, 10, 7. [Google Scholar] [CrossRef] [PubMed]
  10. Edwards, L.A.; O’Neill, C.; Furman, M.A.; Hicks, S.; Torrente, F.; Pérez-Machado, M.; Wellington, E.M.; Phillips, A.D.; Murch, S.H. Enterotoxin-producing staphylococci cause intestinal inflammation by a combination of direct epithelial cytopathy and superantigen-mediated T-cell activation. Inflamm. Bowel Dis. 2012, 18, 624–640. [Google Scholar] [CrossRef]
  11. Wang, J.; Qi, L.; Wu, Z.; Mei, L.; Wang, H. Different effects of lipoteichoic acid from Clostridium butyricum and Staphylococcus aureus on inflammatory responses of HT-29 cells. Int. J. Biol. Macromol. 2016, 87, 481–487. [Google Scholar] [CrossRef]
  12. Hattar, K.; Grandel, U.; Moeller, A.; Fink, L.; Iglhaut, J.; Hartung, T.; Morath, S.; Seeger, W.; Grimminger, F.; Sibelius, U. Lipoteichoic acid (LTA) from Staphylococcus aureus stimulates human neutrophil cytokine release by a CD14-dependent, Toll-like-receptor-independent mechanism: Autocrine role of tumor necrosis factor-α in mediating LTA-induced interleukin-8 generation. Crit. Care Med. 2006, 34, 835. [Google Scholar] [CrossRef] [PubMed]
  13. Hersh, D.; Weiss, J.; Zychlinsky, A. How bacteria initiate inflammation: Aspects of the emerging story. Curr. Opin. Microbiol. 1998, 1, 43–48. [Google Scholar] [CrossRef]
  14. Jung, H.C.; Eckmann, L.; Yang, S.K.; Panja, A.; Fierer, J.; Morzycka-Wroblewska, E.; Kagnoff, M.F. A distinct array of proinflammatory cytokines is expressed in human colon epithelial cells in response to bacterial invasion. J. Clin. Investig. 1995, 95, 55–65. [Google Scholar] [CrossRef]
  15. Kaminsky, L.W.; Al-Sadi, R.; Ma, T.Y. IL-1β and the Intestinal Epithelial Tight Junction Barrier. Front. Immunol. 2021, 12, 767456. [Google Scholar] [CrossRef]
  16. di Vito, R.; Conte, C.; Traina, G. A Multi-Strain Probiotic Formulation Improves Intestinal Barrier Function by the Modulation of Tight and Adherent Junction Proteins. Cells 2022, 11, 2617. [Google Scholar] [CrossRef]
  17. Pires, S.; Parker, D. IL-1β activation in response to Staphylococcus aureus lung infection requires inflammasome-dependent and independent mechanisms. Eur. J. Immunol. 2018, 48, 1707–1716. [Google Scholar] [CrossRef]
  18. Volk, C.F.; Burgdorf, S.; Edwardson, G.; Nizet, V.; Sakoulas, G.; Rose, W.E. Interleukin (IL)-1β and IL-10 host responses in patients with Staphylococcus aureus bacteremia determined by antimicrobial therapy. Clin. Infect. Dis. 2020, 70, 2634–2640. [Google Scholar] [CrossRef] [PubMed]
  19. Gutierrez Jauregui, R.; Fleige, H.; Bubke, A.; Rohde, M.; Weiss, S.; Förster, R. IL-1β promotes Staphylococcus aureus biofilms on implants in vivo. Front. Immunol. 2019, 10, 1082. [Google Scholar] [CrossRef]
  20. Kanangat, S.; Bronze, M.S.; Meduri, G.U.; Postlethwaite, A.; Stentz, F.; Tolley, E.; Schaberg, D. Enhanced extracellular growth of Staphylococcus aureus in the presence of selected linear peptide fragments of human interleukin (IL)-1β and IL-1 receptor antagonist. J. Infect. Dis. 2001, 183, 65–69. [Google Scholar] [CrossRef] [PubMed]
  21. Li, Z.; Peres, A.G.; Damian, A.C.; Madrenas, J. Immunomodulation and Disease Tolerance to Staphylococcus aureus. Pathogens 2015, 4, 793–815. [Google Scholar] [CrossRef]
  22. Ohkusa, T.; Yoshida, T.; Sato, N.; Watanabe, S.; Tajiri, H.; Okayasu, I. Commensal bacteria can enter colonic epithelial cells and induce proinflammatory cytokine secretion: A possible pathogenic mechanism of ulcerative colitis. J. Med. Microbiol. 2009, 58, 535–545. [Google Scholar] [CrossRef]
  23. Sellon, R.K.; Tonkonogy, S.; Schultz, M.; Dieleman, L.A.; Grenther, W.; Balish, E.; Rennick, D.M.; Sartor, R.B. Resident Enteric Bacteria Are Necessary for Development of Spontaneous Colitis and Immune System Activation in Interleukin-10-Deficient Mice. Infect. Immun. 1998, 66, 5224–5231. [Google Scholar] [CrossRef]
  24. Krawczyk, B.; Wityk, P.; Gałęcka, M.; Michalik, M. The Many Faces of Enterococcus spp.—Commensal, Probiotic and Opportunistic Pathogen. Microorganisms 2021, 9, 1900. [Google Scholar] [CrossRef] [PubMed]
  25. Buňková, L.; Buňka, F.; Dráb, V.; Kráčmar, S.; Kubáň, V. Effects of NaCl, lactose and availability of oxygen on tyramine production by the Enterococcus durans CCDM 53. Eur. Food Res. Technol. 2012, 234, 973–979. [Google Scholar] [CrossRef]
  26. Hanchi, H.; Mottawea, W.; Sebei, K.; Hammami, R. The Genus Enterococcus: Between Probiotic Potential and Safety Concerns—An Update. Front. Microbiol. 2018, 9, 1791. [Google Scholar] [CrossRef]
  27. Nami, Y.; Vaseghi Bakhshayesh, R.; Mohammadzadeh Jalaly, H.; Lotfi, H.; Eslami, S.; Hejazi, M.A. Probiotic Properties of Enterococcus Isolated From Artisanal Dairy Products. Front. Microbiol. 2019, 10, 300. [Google Scholar] [CrossRef] [PubMed]
  28. Taras, D.; Vahjen, W.; Macha, M.; Simon, O. Performance, diarrhea incidence, and occurrence of Escherichia coli virulence genes during long-term administration of a probiotic Enterococcus faecium strain to sows and piglets. J. Anim. Sci. 2006, 84, 608–617. [Google Scholar] [CrossRef] [PubMed]
  29. Żółkiewicz, J.; Marzec, A.; Ruszczyński, M.; Feleszko, W. Postbiotics—A Step Beyond Pre- and Probiotics. Nutrients 2020, 12, 2189. [Google Scholar] [CrossRef]
  30. Moradi, M.; Tajik, H.; Mardani, K.; Ezati, P. Efficacy of lyophilized cell-free supernatant of Lactobacillus salivarius (Ls-BU2) on Escherichia coli and shelf life of ground beef. Vet. Res. Forum 2019, 10, 193–198. [Google Scholar] [CrossRef]
  31. Wegh, C.A.M.; Geerlings, S.Y.; Knol, J.; Roeselers, G.; Belzer, C. Postbiotics and their potential applications in early life nutrition and beyond. Int. J. Mol. Sci. 2019, 20, 4673. [Google Scholar] [CrossRef]
  32. Fong, F.L.Y.; Kirjavainen, P.V.; El-Nezami, H. Immunomodulation of Lactobacillus rhamnosus GG (LGG)-derived soluble factors on antigen-presenting cells of healthy blood donors. Sci. Rep. 2016, 6, 22845. [Google Scholar] [CrossRef]
  33. Mariano, V.; McCrindle, C.M.; Cenci-Goga, B.; Picard, J.A. Case-control study to determine whether river water can spread tetracycline resistance to unexposed impala (Aepyceros melampus) in Kruger National Park (South Africa). Appl. Environ. Microbiol. 2009, 75, 113–118. [Google Scholar] [CrossRef]
  34. Salminen, S.; Collado, M.C.; Endo, A.; Hill, C.; Lebeer, S.; Quigley, E.M.M.; Sanders, M.E.; Shamir, R.; Swann, J.R.; Szajewska, H.; et al. The International Scientific Association of Probiotics and Prebiotics (ISAPP) consensus statement on the definition and scope of postbiotics. Nat. Rev. Gastroenterol. Hepatol. 2021, 18, 649–667. [Google Scholar] [CrossRef] [PubMed]
  35. Liang, B.; Xing, D. The Current and Future Perspectives of Postbiotics. Probiotics Antimicrob. Proteins 2023, 15, 1626–1643. [Google Scholar] [CrossRef]
  36. Das, D.J.; Shankar, A.; Johnson, J.B.; Thomas, S. Critical insights into antibiotic resistance transferability in probiotic Lactobacillus. Nutrition 2020, 69, 110567. [Google Scholar] [CrossRef] [PubMed]
  37. Daneshmandi, L.; Shah, S.; Jafari, T.; Bhattacharjee, M.; Momah, D.; Saveh-Shemshaki, N.; Lo, K.W.H.; Laurencin, C.T. Emergence of the Stem Cell Secretome in Regenerative Engineering. Trends Biotechnol. 2020, 38, 1373–1384. [Google Scholar] [CrossRef]
  38. Zubair, M.; Khan, F.A.; Menghwar, H.; Faisal, M.; Ashraf, M.; Rasheed, M.A.; Marawan, M.A.; Dawood, A.; Chen, Y.; Chen, H.; et al. Progresses on bacterial secretomes enlighten research on Mycoplasma secretome. Microb. Pathog. 2020, 144, 104160. [Google Scholar] [CrossRef] [PubMed]
  39. Tsolis, K.C.; Hamed, M.B.; Simoens, K.; Koepff, J.; Busche, T.; Rückert, C.; Oldiges, M.; Kalinowski, J.; Anné, J.; Kormanec, J.; et al. Secretome Dynamics in a Gram-Positive Bacterial Model. Mol. Cell. Proteom. 2019, 18, 423–436. [Google Scholar] [CrossRef]
  40. Abdelhamid, A.G.; Esaam, A.; Hazaa, M.M. Cell free preparations of probiotics exerted antibacterial and antibiofilm activities against multidrug resistant Escherichia coli. Saudi Pharm. J. 2018, 26, 603–607. [Google Scholar] [CrossRef]
  41. Ebrahimi, M.; Sadeghi, A.; Rahimi, D.; Purabdolah, H.; Shahryari, S. Postbiotic and Anti-aflatoxigenic Capabilities of Lactobacillus kunkeei as the Potential Probiotic LAB Isolated from the Natural Honey. Probiotics Antimicrob. Proteins 2021, 13, 343–355. [Google Scholar] [CrossRef]
  42. Johnson, C.N.; Kogut, M.H.; Genovese, K.; He, H.; Kazemi, S.; Arsenault, R.J. Administration of a Postbiotic Causes Immunomodulatory Responses in Broiler Gut and Reduces Disease Pathogenesis Following Challenge. Microorganisms 2019, 7, 268. [Google Scholar] [CrossRef]
  43. Vitiello, M.; D’Isanto, M.; Galdiero, M.; Raieta, K.; Tortora, A.; Rotondo, P.; Peluso, L.; Galdiero, M. Interleukin-8 production by THP-1 cells stimulated by Salmonella enterica serovar Typhimurium porins is mediated by AP-1, NF-κB and MAPK pathways. Cytokine 2004, 27, 15–24. [Google Scholar] [CrossRef]
  44. Leroy, F.; Charmpi, C.; Vuyst, L.D. Meat fermentation at a crossroads: Where the age-old interplay of human, animal, and microbial diversity and contemporary markets meet. FEMS Microbiol. Rev. 2023, 47, fuad016. [Google Scholar] [CrossRef]
  45. Popović, N.; Djokić, J.; Brdarić, E.; Dinić, M.; Terzić-Vidojević, A.; Golić, N.; Veljović, K. The Influence of Heat-Killed Enterococcus faecium BGPAS1-3 on the Tight Junction Protein Expression and Immune Function in Differentiated Caco-2 Cells Infected With Listeria monocytogenes ATCC 19111. Front. Microbiol. 2019, 10, 412. [Google Scholar] [CrossRef]
  46. Choi, H.J.; Shin, M.S.; Lee, S.M.; Lee, W.K. Immunomodulatory properties of Enterococcus faecium JWS 833 isolated from duck intestinal tract and suppression of Listeria monocytogenes infection. Microbiol. Immunol. 2012, 56, 613–620. [Google Scholar] [CrossRef] [PubMed]
  47. Molina, M.A.; Díaz, A.M.; Hesse, C.; Ginter, W.; Gentilini, M.V.; Nuñez, G.G.; Canellada, A.M.; Sparwasser, T.; Berod, L.; Castro, M.S.; et al. Immunostimulatory Effects Triggered by Enterococcus faecalis CECT7121 Probiotic Strain Involve Activation of Dendritic Cells and Interferon-Gamma Production. PLoS ONE 2015, 10, e0127262. [Google Scholar] [CrossRef] [PubMed]
  48. Pradhan, D.; Avadhani, R.; Mallappa, R.H.; Soumya, K.; Gupta, S. Comparative Evaluation of Anti-Inflammatory Effects of Postbiotic and Probiotic Lactobacilli in HT-29 Cells and Colitis Mouse Model. Food Biotechnol. 2025, 39, 414–435. [Google Scholar] [CrossRef]
  49. Ohtsuki, Y.; Nakamura, E.; Asakami, M.; Morikawa, R.; Tokumura, A. Inhibitory Effects of Lysophospholipids on Survival and Interleukin-8 Secretion of HT-29, a Human Colon Cancer-Derived Epithelial Cell. Biol. Pharm. Bull. 2025, 48, 119–125. [Google Scholar] [CrossRef]
  50. Majdoddin, M.A.; Safari, F. Investigating the Impact of the Secretome From hAMSCs on HT-29 Colon Cancer Cells via TNF-α/TGF-β/c-MYC Signaling Pathways Using a Three-Dimensional Cell Culture Model. Immun. Inflamm. Dis. 2025, 13, e70283. [Google Scholar] [CrossRef]
  51. Raz, I.; Gollop, N.; Polak-Charcon, S.; Schwartz, B. Isolation and characterisation of new putative probiotic bacteria from human colonic flora. Br. J. Nutr. 2007, 97, 725–734. [Google Scholar] [CrossRef]
  52. Avram-Hananel, L.; Stock, J.; Parlesak, A.; Bode, C.; Schwartz, B. Enterococcus durans strain M4–5 isolated from human colonic flora attenuates intestinal inflammation. Dis. Colon Rectum 2010, 53, 1676. [Google Scholar] [CrossRef]
  53. Daig, R.; Rogler, G.; Aschenbrenner, E.; Vogl, D.; Falk, W.; Gross, V.; Schölmerich, J.; Andus, T. Human intestinal epithelial cells secrete interleukin-1 receptor antagonist and interleukin-8 but not interleukin-1 or interleukin-6. Gut 2000, 46, 350–358. [Google Scholar] [CrossRef]
  54. Ichikawa, Y.; Takahashi, H.; Chinen, Y.; Arita, A.; Sekido, Y.; Hata, T.; Ogino, T.; Miyoshi, N.; Uemura, M.; Yamamoto, H.; et al. Low G9a expression is a tumor progression factor of colorectal cancer via IL-8 promotion. Carcinogenesis 2022, 43, 797–807. [Google Scholar] [CrossRef] [PubMed]
  55. Ma, D.; Forsythe, P.; Bienenstock, J. Live Lactobacillus rhamnosus Is Essential for the Inhibitory Effect on Tumor Necrosis Factor Alpha-Induced Interleukin-8 Expression. Infect. Immun. 2011, 79, 2961. [Google Scholar] [CrossRef]
  56. McCracken, V.J.; Chun, T.; Baldeón, M.E.; Ahrné, S.; Molin, G.; Mackie, R.I.; Gaskins, H.R. TNF-α sensitizes HT-29 colonic epithelial cells to intestinal Lactobacilli. Exp. Biol. Med. 2002, 227, 665–670. [Google Scholar] [CrossRef]
  57. Jeffrey, M.P.; Strap, J.L.; Jones Taggart, H.; Green-Johnson, J.M. Suppression of Intestinal Epithelial Cell Chemokine Production by Lactobacillus rhamnosus R0011 and Lactobacillus helveticus R0389 Is Mediated by Secreted Bioactive Molecules. Front. Immunol. 2018, 9, 2639. [Google Scholar] [CrossRef] [PubMed]
  58. Zecconi, A.; Scali, F. Staphylococcus aureus virulence factors in evasion from innate immune defenses in human and animal diseases. Immunol. Lett. 2013, 150, 12–22. [Google Scholar] [CrossRef]
  59. Teymournejad, O.; Montgomery, C.P. Evasion of Immunological Memory by S. aureus Infection: Implications for Vaccine Design. Front. Immunol. 2021, 12, 633672. [Google Scholar] [CrossRef]
  60. Hajam, I.A.; Liu, G.Y. Linking, S. aureus Immune Evasion Mechanisms to Staphylococcal Vaccine Failures. Antibiotics 2024, 13, 410. [Google Scholar] [CrossRef] [PubMed]
  61. Bear, A.; Locke, T.; Rowland-Jones, S.; Pecetta, S.; Bagnoli, F.; Darton, T.C. The immune evasion roles of Staphylococcus aureus protein A and impact on vaccine development. Front. Cell. Infect. Microbiol. 2023, 13, 1242702. [Google Scholar] [CrossRef]
  62. Heim, C.E.; Vidlak, D.; Scherr, T.D.; Kozel, J.A.; Holzapfel, M.; Muirhead, D.E.; Kielian, T. Myeloid-derived suppressor cells contribute to Staphylococcus aureus orthopedic biofilm infection. J. Immunol. 2014, 192, 3778–3792. [Google Scholar] [CrossRef]
  63. Leech, J.M.; Lacey, K.A.; Mulcahy, M.E.; Medina, E.; McLoughlin, R.M. IL-10 Plays Opposing Roles during Staphylococcus aureus Systemic and Localized Infections. J. Immunol. 2017, 198, 2352–2365. [Google Scholar] [CrossRef] [PubMed]
  64. Prince, A. Staphylococcus aureus metabolites promote IL-10. Nat. Microbiol. 2020, 5, 1183–1184. [Google Scholar] [CrossRef] [PubMed]
  65. Govari, M.; Pexara, A. Occurrence of Staphylococcus aureus TSST-1 in Foods: A Review. Toxins 2025, 17, 606. [Google Scholar] [CrossRef] [PubMed]
  66. Neish, A.S.; Gewirtz, A.T.; Zeng, H.; Young, A.N.; Hobert, M.E.; Karmali, V.; Rao, A.S.; Madara, J.L. Prokaryotic Regulation of Epithelial Responses by Inhibition of IκB-α Ubiquitination. Science 2000, 289, 1560–1563. [Google Scholar] [CrossRef]
Microbiolres 17 00089 g001
Figure 1. Cell viability of HT-29 cells after treatment with E. durans CFS (a) or S. aureus CFS (b) treatment. Values are reported with respect to control cells set as 100%. All results are expressed as mean ± S.D. of 4 samples. Statistical significance: # p < 0.05 vs. control.
Figure 1. Cell viability of HT-29 cells after treatment with E. durans CFS (a) or S. aureus CFS (b) treatment. Values are reported with respect to control cells set as 100%. All results are expressed as mean ± S.D. of 4 samples. Statistical significance: # p < 0.05 vs. control.
Microbiolres 17 00089 g001
Microbiolres 17 00089 g002
Figure 2. Effects of E. durans CFS alone, S. aureus CFS alone or E. durans CFS plus S. aureus CF on gene expression levels of IL-8 (a), IL-1β (b), IL-10 (c) in HT-29 cells. Data represent mean ± S.D. of 3 samples. Statistical significance: # p < 0.05 vs. control, * p < 0.05 between two experimental groups.
Figure 2. Effects of E. durans CFS alone, S. aureus CFS alone or E. durans CFS plus S. aureus CF on gene expression levels of IL-8 (a), IL-1β (b), IL-10 (c) in HT-29 cells. Data represent mean ± S.D. of 3 samples. Statistical significance: # p < 0.05 vs. control, * p < 0.05 between two experimental groups.
Microbiolres 17 00089 g002
Table 1. Primer sequences.
Table 1. Primer sequences.
GenePrimerSequence (5′ → 3′)
IL-8 forward GACATACTCCAAACCTTTCCA
reverse AACTTCTCCACAACCCTCT
IL-10 forward GCTTCTGGTGAAGGAGGATC
reverse TCTTGGTTCTCAGCTTGGGG
IL-1β forward GGACCTGGACCTCTGCCCTCTGG
reverse GCCTGCCTGAAGCCCTTGCTGTAG
GAPDH forward TGGTATCGTGGAAGGACTCATGAC
reverse ATGCCAGTGAGCTTCCCGTTCAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Costanzi, E.; Traina, G.; Misuraca, M.; Msakni, D.; Sgaravizzi, G.; Karama, M.; Al-Olayan, E.; El-Ashram, S.; Martinez-Barbitta, M.; Zerani, M.; et al. Enterococcus durans Secretome Modulates Interleukins Gene Expressions in Intestinal Epithelial Cells Challenged by Staphylococcus aureus Secretome: In Vitro Study on the HT-29 Cell Line. Microbiol. Res. 2026, 17, 89. https://doi.org/10.3390/microbiolres17050089

AMA Style

Costanzi E, Traina G, Misuraca M, Msakni D, Sgaravizzi G, Karama M, Al-Olayan E, El-Ashram S, Martinez-Barbitta M, Zerani M, et al. Enterococcus durans Secretome Modulates Interleukins Gene Expressions in Intestinal Epithelial Cells Challenged by Staphylococcus aureus Secretome: In Vitro Study on the HT-29 Cell Line. Microbiology Research. 2026; 17(5):89. https://doi.org/10.3390/microbiolres17050089

Chicago/Turabian Style

Costanzi, Egidia, Giovanna Traina, Marco Misuraca, Donia Msakni, Giada Sgaravizzi, Musafiri Karama, Ebtesam Al-Olayan, Saeed El-Ashram, Marcelo Martinez-Barbitta, Massimo Zerani, and et al. 2026. "Enterococcus durans Secretome Modulates Interleukins Gene Expressions in Intestinal Epithelial Cells Challenged by Staphylococcus aureus Secretome: In Vitro Study on the HT-29 Cell Line" Microbiology Research 17, no. 5: 89. https://doi.org/10.3390/microbiolres17050089

APA Style

Costanzi, E., Traina, G., Misuraca, M., Msakni, D., Sgaravizzi, G., Karama, M., Al-Olayan, E., El-Ashram, S., Martinez-Barbitta, M., Zerani, M., & Cenci-Goga, B. T. (2026). Enterococcus durans Secretome Modulates Interleukins Gene Expressions in Intestinal Epithelial Cells Challenged by Staphylococcus aureus Secretome: In Vitro Study on the HT-29 Cell Line. Microbiology Research, 17(5), 89. https://doi.org/10.3390/microbiolres17050089

Article Metrics

Back to TopTop