Possible Role of NRF2 in Cell Response to OZOILE (Stable Ozonides) in Children Affected by Lichen Sclerosus of Foreskin
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Patients Recruitment
2.3. Gene Expression Analysis by Real-Time PCR
2.4. Western Blotting
2.5. Power and Sample Size Analysis
2.6. Statistical Analysis
3. Results
4. Discussion
Limitations of the Study
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Breisky, A. Ueber Kraurosis Vulvae: Eine Wenig Beachtete Form von Hautatrophie am Pudendum Muliebre; Zeitschr. f. Heilk.: Wien, Austria, 1885. [Google Scholar]
- Hallopeau, H.J.U.M.C. Leçons cliniques sur les maladées cutanées et syphiliques. Première leçon, suite et fin. Le lichen plan atrophique. Union Méd. Can. 1887, 43, 742–747. [Google Scholar]
- Bercaw-Pratt, J.L.; Boardman, L.A.; Simms-Cendan, J.S.; North American Society for Pediatric and Adolescent Gynecology. Clinical recommendation: Pediatric lichen sclerosus. J. Pediatr. Adolesc. Gynecol. 2014, 27, 111–116. [Google Scholar] [CrossRef]
- Powell, J.J.; Wojnarowska, F. Lichen sclerosus. Lancet 1999, 353, 1777–1783. [Google Scholar] [CrossRef] [PubMed]
- Kiss, A.; Kiraly, L.; Kutasy, B.; Merksz, M. High incidence of balanitis xerotica obliterans in boys with phimosis: Prospective 10-year study. Pediatr. Dermatol. 2005, 22, 305–308. [Google Scholar] [CrossRef]
- Celis, S.; Reed, F.; Murphy, F.; Adams, S.; Gillick, J.; Abdelhafeez, A.H.; Lopez, P.J. Balanitis xerotica obliterans in children and adolescents: A literature review and clinical series. J. Pediatr. Urol. 2014, 10, 34–39. [Google Scholar] [CrossRef] [PubMed]
- Neill, S.M.; Lewis, F.M.; Tatnall, F.M.; Cox, N.H.; British Association of Dermatologists. British Association of Dermatologists’ guidelines for the management of lichen sclerosus 2010. Br. J. Dermatol. 2010, 163, 672–682. [Google Scholar] [CrossRef] [PubMed]
- Becker, K.; Meissner, V.; Farwick, W.; Bauer, R.; Gaiser, M.R. Lichen sclerosus and atopy in boys: Coincidence or correlation? Br. J. Dermatol. 2013, 168, 362–366. [Google Scholar] [CrossRef]
- Li, J.; Deng, C.; Peng, Q. Underestimation of genital lichen sclerosus incidence in boys with phimosis: Results from a systematic review. Pediatr. Surg. Int. 2018, 34, 1245–1250. [Google Scholar] [CrossRef] [PubMed]
- Stühmer, A. Balanitis xerotica obliterans (post operationem) und ihre Beziehungen zur “Kraurosis glandis et praeputii penis”. Arch. Für Dermatol. Syph. 1928, 156, 613–623. [Google Scholar] [CrossRef]
- Papini, M.; Russo, A.; Simonetti, O.; Borghi, A.; Corazza, M.; Piaserico, S.; Feliciani, C.; Calzavara-Pinton, P.; Mucous Membrane Disorders Research Group of SIDeMaST. Diagnosis and management of cutaneous and anogenital lichen sclerosus: Recommendations from the Italian Society of Dermatology (SIDeMaST). Ital. J. Dermatol. Venerol. 2021, 156, 519–533. [Google Scholar] [CrossRef]
- Guarneri, F.; Giuffrida, R.; Di Bari, F.; Cannavo, S.P.; Benvenga, S. Thyroid Autoimmunity and Lichen. Front. Endocrinol. 2017, 8, 146. [Google Scholar] [CrossRef]
- Kirtschig, G.; Becker, K.; Gunthert, A.; Jasaitiene, D.; Cooper, S.; Chi, C.C.; Kreuter, A.; Rall, K.K.; Aberer, W.; Riechardt, S.; et al. Evidence-based (S3) Guideline on (anogenital) Lichen sclerosus. J. Eur. Acad. Dermatol. Venereol. 2015, 29, e1–e43. [Google Scholar] [CrossRef]
- Russo, T.; Curro, M.; Barbera, A.; Caccamo, D.; Antonuccio, P.; Arena, S.; Montalto, A.S.; Parisi, S.; Marseglia, L.; Gitto, E.; et al. Expression of Transglutaminase in Foreskin of Children with Balanitis Xerotica Obliterans. Int. J. Mol. Sci. 2016, 17, 1551. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, A.T.M.; Holland, A.J.A. Balanitis xerotica obliterans: An update for clinicians. Eur. J. Pediatr. 2020, 179, 9–16. [Google Scholar] [CrossRef] [PubMed]
- Ghidini, F.; Virgone, C.; Pulvirenti, R.; Trovalusci, E.; Gamba, P. Could a careful clinical examination distinguish physiologic phimosis from balanitis xerotica obliterans in children? Eur. J. Pediatr. 2021, 180, 591–595. [Google Scholar] [CrossRef] [PubMed]
- Arena, S.; Ieni, A.; Curro, M.; Vaccaro, M.; Di Fabrizio, D.; Cassaro, F.; Bonfiglio, R.; Montalto, A.S.; Tuccari, G.; Alibrandi, A.; et al. Immunohistological Analysis of Lichen Sclerosus of the Foreskin in Pediatric Age: Could It Be Considered a Premalignant Lesion? Biomedicines 2023, 11, 1986. [Google Scholar] [CrossRef]
- Kumar, K.S.; Morrel, B.; van Hees, C.L.M.; van der Toorn, F.; van Dorp, W.; Mendels, E.J. Comparison of lichen sclerosus in boys and girls: A systematic literature review of epidemiology, symptoms, genetic background, risk factors, treatment, and prognosis. Pediatr. Dermatol. 2022, 39, 400–408. [Google Scholar] [CrossRef]
- Smith, Y.R.; Quint, E.H. Clobetasol propionate in the treatment of premenarchal vulvar lichen sclerosus. Obstet. Gynecol. 2001, 98, 588–591. [Google Scholar] [CrossRef]
- De Luca, D.A.; Papara, C.; Vorobyev, A.; Staiger, H.; Bieber, K.; Thaci, D.; Ludwig, R.J. Lichen sclerosus: The 2023 update. Front. Med. 2023, 10, 1106318. [Google Scholar] [CrossRef] [PubMed]
- Virgili, A.; Minghetti, S.; Borghi, A.; Corazza, M. Long-term maintenance therapy for vulvar lichen sclerosus: The results of a randomized study comparing topical vitamin E with an emollient. Eur. J. Dermatol. 2013, 23, 189–194. [Google Scholar] [CrossRef]
- Curro, M.; Russo, T.; Ferlazzo, N.; Caccamo, D.; Antonuccio, P.; Arena, S.; Parisi, S.; Perrone, P.; Ientile, R.; Romeo, C.; et al. Anti-Inflammatory and Tissue Regenerative Effects of Topical Treatment with Ozonated Olive Oil/Vitamin E Acetate in Balanitis Xerotica Obliterans. Molecules 2018, 23, 645. [Google Scholar] [CrossRef] [PubMed]
- Russo, T.; Curro, M.; Ferlazzo, N.; Caccamo, D.; Perrone, P.; Arena, S.; Antonelli, E.; Antonuccio, P.; Ientile, R.; Romeo, C.; et al. Stable Ozonides with Vitamin E Acetate versus Corticosteroid in the Treatment of Lichen Sclerosus in Foreskin: Evaluation of Effects on Inflammation. Urol. Int. 2019, 103, 459–465. [Google Scholar] [CrossRef] [PubMed]
- Pugliese, J.M.; Morey, A.F.; Peterson, A.C. Lichen sclerosus: Review of the literature and current recommendations for management. J. Urol. 2007, 178, 2268–2276. [Google Scholar] [CrossRef]
- Bochove-Overgaauw, D.M.; Gelders, W.; De Vylder, A.M. Routine biopsies in pediatric circumcision: (Non) sense? J. Pediatr. Urol. 2009, 5, 178–180. [Google Scholar] [CrossRef]
- Naji, H.; Jawad, E.; Ahmed, H.A.; Mustafa, R. Histopathological examination of the prepuce after circumcision: Is it a waste of resources? Afr. J. Paediatr. Surg. 2013, 10, 164–166. [Google Scholar] [CrossRef]
- Potts, B.A.; Belsante, M.J.; Peterson, A.C. Intraurethral Steroids are a Safe and Effective Treatment for Stricture Disease in Patients with Biopsy Proven Lichen Sclerosus. J. Urol. 2016, 195, 1790–1796. [Google Scholar] [CrossRef]
- Homer, L.; Buchanan, K.J.; Nasr, B.; Losty, P.D.; Corbett, H.J. Meatal stenosis in boys following circumcision for lichen sclerosus (balanitis xerotica obliterans). J. Urol. 2014, 192, 1784–1788. [Google Scholar] [CrossRef]
- Christman, M.S.; Chen, J.T.; Holmes, N.M. Obstructive complications of lichen sclerosus. J. Pediatr. Urol. 2009, 5, 165–169. [Google Scholar] [CrossRef] [PubMed]
- Sancaktutar, A.A.; Kilincaslan, H.; Atar, M.; Soylemez, H.; Penbegul, N.; Bozkurt, Y.; Tepeler, A. Severe phimosis leading to obstructive uropathy in a boy with lichen sclerosus. Scand. J. Urol. Nephrol. 2012, 46, 371–374. [Google Scholar] [CrossRef]
- Hughes, K.E.; Corbett, H.J. Ultrasound evidence of bladder outlet obstruction secondary to lichen sclerosus et atrophicus in boys (balanitis xerotica obliterans). J. Pediatr. Surg. 2020, 55, 721–725. [Google Scholar] [CrossRef] [PubMed]
- Arena, S.; Russo, T.; Impellizzeri, P.; Parisi, S.; Perrone, P.; Romeo, C. Utility of uroflowmetry during the follow-up of children affected by balanitis xerotica obliterans (BXO). Arch. Ital. Urol. Androl. 2018, 90, 123–126. [Google Scholar] [CrossRef] [PubMed]
- Paulis, G.; Berardesca, E. Lichen sclerosus: The role of oxidative stress in the pathogenesis of the disease and its possible transformation into carcinoma. Res. Rep. Urol. 2019, 11, 223–232. [Google Scholar] [CrossRef] [PubMed]
- Pradhan, A.; Patel, R.; Said, A.J.; Upadhyaya, M. 10 Years’ Experience in Balanitis Xerotica Obliterans: A Single-Institution Study. Eur. J. Pediatr. Surg. 2019, 29, 302–306. [Google Scholar] [CrossRef] [PubMed]
- Kiss, A.; Csontai, A.; Pirot, L.; Nyirady, P.; Merksz, M.; Kiraly, L. The response of balanitis xerotica obliterans to local steroid application compared with placebo in children. J. Urol. 2001, 165, 219–220. [Google Scholar] [CrossRef]
- Poindexter, G.; Morrell, D.S. Anogenital pruritus: Lichen sclerosus in children. Pediatr. Ann. 2007, 36, 785–791. [Google Scholar] [CrossRef]
- Chi, C.C.; Kirtschig, G.; Baldo, M.; Lewis, F.; Wang, S.H.; Wojnarowska, F. Systematic review and meta-analysis of randomized controlled trials on topical interventions for genital lichen sclerosus. J. Am. Acad. Dermatol. 2012, 67, 305–312. [Google Scholar] [CrossRef]
- Ebert, A.K.; Rosch, W.H.; Vogt, T. Safety and tolerability of adjuvant topical tacrolimus treatment in boys with lichen sclerosus: A prospective phase 2 study. Eur. Urol. 2008, 54, 932–937. [Google Scholar] [CrossRef] [PubMed]
- Dahlman-Ghozlan, K.; Hedblad, M.A.; von Krogh, G. Penile lichen sclerosus et atrophicus treated with clobetasol dipropionate 0.05% cream: A retrospective clinical and histopathological study. J. Am. Acad. Dermatol. 1999, 40, 451–457. [Google Scholar] [CrossRef] [PubMed]
- Smith, S.D.; Hong, E.; Fearns, S.; Blaszczynski, A.; Fischer, G. Corticosteroid phobia and other confounders in the treatment of childhood atopic dermatitis explored using parent focus groups. Australas. J. Dermatol. 2010, 51, 168–174. [Google Scholar] [CrossRef] [PubMed]
- Borghi, A.; Corazza, M.; Minghetti, S.; Toni, G.; Virgili, A. Avocado and soybean extracts as active principles in the treatment of mild-to-moderate vulvar lichen sclerosus: Results of efficacy and tolerability. J. Eur. Acad. Dermatol. Venereol. 2015, 29, 1225–1230. [Google Scholar] [CrossRef]
- Patel, P.V.; Kumar, V.; Kumar, S.; Gd, V.; Patel, A. Therapeutic effect of topical ozonated oil on the epithelial healing of palatal wound sites: A planimetrical and cytological study. J. Investig. Clin. Dent. 2011, 2, 248–258. [Google Scholar] [CrossRef]
- Napolitano, G.; Fasciolo, G.; Venditti, P. The Ambiguous Aspects of Oxygen. Oxygen 2022, 2, 382–409. [Google Scholar] [CrossRef]
- Travagli, V.; Zanardi, I.; Bocci, V. Topical applications of ozone and ozonated oils as anti-infective agents: An insight into the patent claims. Recent. Pat. Antiinfect. Drug Discov. 2009, 4, 130–142. [Google Scholar] [CrossRef] [PubMed]
- Sechi, L.A.; Lezcano, I.; Nunez, N.; Espim, M.; Dupre, I.; Pinna, A.; Molicotti, P.; Fadda, G.; Zanetti, S. Antibacterial activity of ozonized sunflower oil (Oleozon). J. Appl. Microbiol. 2001, 90, 279–284. [Google Scholar] [CrossRef] [PubMed]
- Ramamoorthy, S.; Cidlowski, J.A. Corticosteroids: Mechanisms of Action in Health and Disease. Rheum. Dis. Clin. N. Am. 2016, 42, 15–31, vii. [Google Scholar] [CrossRef]
- Nissen, R.M.; Yamamoto, K.R. The glucocorticoid receptor inhibits NFkappaB by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev. 2000, 14, 2314–2329. [Google Scholar] [CrossRef]
- Rogatsky, I.; Ivashkiv, L.B. Glucocorticoid modulation of cytokine signaling. Tissue Antigens 2006, 68, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Costa, S.; Tedeschi, P.; Ferraro, L.; Beggiato, S.; Grandini, A.; Manfredini, S.; Buzzi, R.; Sacchetti, G.; Valacchi, G. Biological activity of new bioactive steroids deriving from biotransformation of cortisone. Microb. Cell Fact. 2022, 21, 250. [Google Scholar] [CrossRef]
- Cheng, W.; Song, Y.; Liu, Y.; Sun, X.; Ren, W. Impact of Dexamethasone Preconditioning on Prevention of Development of Cognitive Impairment following Acute Inflammation. Contrast Media Mol. Imaging 2022, 2022, 6064007. [Google Scholar] [CrossRef]
- Michel, G.; Nowok, K.; Beetz, A.; Ried, C.; Kemeny, L.; Ruzicka, T. Novel steroid derivative modulates gene expression of cytokines and growth regulators. Skin Pharmacol. 1995, 8, 215–220. [Google Scholar] [CrossRef]
- Barton, B.E.; Jakway, J.P.; Smith, S.R.; Siegel, M.I. Cytokine inhibition by a novel steroid, mometasone furoate. Immunopharmacol. Immunotoxicol. 1991, 13, 251–261. [Google Scholar] [CrossRef]
- Sagai, M.; Bocci, V. Mechanisms of Action Involved in Ozone Therapy: Is healing induced via a mild oxidative stress? Med. Gas Res. 2011, 1, 29. [Google Scholar] [CrossRef]
- Bocci, V. How a calculated oxidative stress can yield multiple therapeutic effects. Free Radic. Res. 2012, 46, 1068–1075. [Google Scholar] [CrossRef] [PubMed]
- Bocci, V.; Valacchi, G. Nrf2 activation as target to implement therapeutic treatments. Front. Chem. 2015, 3, 4. [Google Scholar] [CrossRef]
- Furukawa, M.; Xiong, Y. BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Mol. Cell. Biol. 2005, 25, 162–171. [Google Scholar] [CrossRef] [PubMed]
- Hybertson, B.M.; Gao, B.; Bose, S.K.; McCord, J.M. Oxidative stress in health and disease: The therapeutic potential of Nrf2 activation. Mol. Asp. Med. 2011, 32, 234–246. [Google Scholar] [CrossRef] [PubMed]
- Hayes, J.D.; Dinkova-Kostova, A.T. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem. Sci. 2014, 39, 199–218. [Google Scholar] [CrossRef] [PubMed]
- Saha, S.; Buttari, B.; Panieri, E.; Profumo, E.; Saso, L. An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules 2020, 25, 5474. [Google Scholar] [CrossRef]
- Galie, M.; Covi, V.; Tabaracci, G.; Malatesta, M. The Role of Nrf2 in the Antioxidant Cellular Response to Medical Ozone Exposure. Int. J. Mol. Sci. 2019, 20, 4009. [Google Scholar] [CrossRef] [PubMed]
- Gao, W.; Guo, L.; Yang, Y.; Wang, Y.; Xia, S.; Gong, H.; Zhang, B.K.; Yan, M. Dissecting the Crosstalk Between Nrf2 and NF-kappaB Response Pathways in Drug-Induced Toxicity. Front. Cell Dev. Biol. 2021, 9, 809952. [Google Scholar] [CrossRef]
- Re, L.; Martinez-Sanchez, G.; Bordicchia, M.; Malcangi, G.; Pocognoli, A.; Morales-Segura, M.A.; Rothchild, J.; Rojas, A. Is ozone pre-conditioning effect linked to Nrf2/EpRE activation pathway in vivo? A preliminary result. Eur. J. Pharmacol. 2014, 742, 158–162. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Liu, X.; Chen, Z.; Chen, H.; Wang, L.; Wang, Z.; Qiu, T.; Weng, X. Ozone therapy could attenuate tubulointerstitial injury in adenine-induced CKD rats by mediating Nrf2 and NF-kappaB. Iran. J. Basic Med. Sci. 2016, 19, 1136–1143. [Google Scholar] [PubMed]
- Valacchi, G.; Sticozzi, C.; Zanardi, I.; Belmonte, G.; Cervellati, F.; Bocci, V.; Travagli, V. Ozone mediators effect on “in vitro” scratch wound closure. Free Radic. Res. 2016, 50, 1022–1031. [Google Scholar] [CrossRef] [PubMed]
- Osipyan, A.; Chen, D.; Dekker, F.J. Epigenetic regulation in macrophage migration inhibitory factor (MIF)-mediated signaling in cancer and inflammation. Drug Discov. Today 2021, 26, 1728–1734. [Google Scholar] [CrossRef]
- Purwar, R.; Kraus, M.; Werfel, T.; Wittmann, M. Modulation of keratinocyte-derived MMP-9 by IL-13: A possible role for the pathogenesis of epidermal inflammation. J. Investig. Dermatol. 2008, 128, 59–66. [Google Scholar] [CrossRef]
- de Oliveira, G.A.; de Almeida, M.P.; Soares, F.A.; de Almeida Filho, G.L.; Takiya, C.M.; Otazu, I.B.; Nasciutti, L.E. Metalloproteinases 2 and 9 and their tissue inhibitors 1 and 2 are increased in vulvar lichen sclerosus. Eur. J. Obstet. Gynecol. Reprod. Biol. 2012, 161, 96–101. [Google Scholar] [CrossRef][Green Version]
- Huang, Y.; Mao, Y.; Li, H.; Shen, G.; Nan, G. Knockdown of Nrf2 inhibits angiogenesis by downregulating VEGF expression through PI3K/Akt signaling pathway in cerebral microvascular endothelial cells under hypoxic conditions. Biochem. Cell Biol. 2018, 96, 475–482. [Google Scholar] [CrossRef]
- Yoon, Y.; Kim, T.J.; Lee, J.M.; Kim, D.Y. SOD2 is upregulated in periodontitis to reduce further inflammation progression. Oral Dis. 2018, 24, 1572–1580. [Google Scholar] [CrossRef] [PubMed]
Target | Primer Sequence 5′ > 3′ | |
---|---|---|
Forward | Reverse | |
NRF2 | CATCACCAGAACACTCAG | CTTCCACTTCAGAATCACT |
p50 | ACACTGGAAGCACGAATGACAGA | CCTCCACCTTCTGCTTGCAA |
p65 | CAGGCGAGAGGAGCACAGATAC | TCCTTTCCTACAAGCTCGTGGG |
MIF | CGGACAGGGTCTACATCAACTATT | CGGCTCTTAGGCGAAGGT |
MMP2 | TGATCTTGACCAGAATACCATCGA | GGCTTGCGAGGGAAGAAGTT |
MMP9 | GAACCAATCTGTTACGGTCAA | GACTCTCCACGCATCTCT |
SOD2 | TGCTGCTTGTCCAAATCAGG | CACACATCAATCCCCAGCAGT |
β-actin | TTGTTACAGGAAGTCCCTTGCC | ATGCTATCACCTCCCCTGTGTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saija, C.; Currò, M.; Arena, S.; Bertuccio, M.P.; Cassaro, F.; Montalto, A.S.; Colonna, M.R.; Caccamo, D.; Romeo, C.; Impellizzeri, P. Possible Role of NRF2 in Cell Response to OZOILE (Stable Ozonides) in Children Affected by Lichen Sclerosus of Foreskin. Curr. Issues Mol. Biol. 2024, 46, 9401-9414. https://doi.org/10.3390/cimb46090557
Saija C, Currò M, Arena S, Bertuccio MP, Cassaro F, Montalto AS, Colonna MR, Caccamo D, Romeo C, Impellizzeri P. Possible Role of NRF2 in Cell Response to OZOILE (Stable Ozonides) in Children Affected by Lichen Sclerosus of Foreskin. Current Issues in Molecular Biology. 2024; 46(9):9401-9414. https://doi.org/10.3390/cimb46090557
Chicago/Turabian StyleSaija, Caterina, Monica Currò, Salvatore Arena, Maria Paola Bertuccio, Fabiola Cassaro, Angela Simona Montalto, Michele Rosario Colonna, Daniela Caccamo, Carmelo Romeo, and Pietro Impellizzeri. 2024. "Possible Role of NRF2 in Cell Response to OZOILE (Stable Ozonides) in Children Affected by Lichen Sclerosus of Foreskin" Current Issues in Molecular Biology 46, no. 9: 9401-9414. https://doi.org/10.3390/cimb46090557
APA StyleSaija, C., Currò, M., Arena, S., Bertuccio, M. P., Cassaro, F., Montalto, A. S., Colonna, M. R., Caccamo, D., Romeo, C., & Impellizzeri, P. (2024). Possible Role of NRF2 in Cell Response to OZOILE (Stable Ozonides) in Children Affected by Lichen Sclerosus of Foreskin. Current Issues in Molecular Biology, 46(9), 9401-9414. https://doi.org/10.3390/cimb46090557