Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences
Abstract
:1. Introduction
2. Materials and Methods
2.1. Species Sampling
2.2. DNA Extraction, PCR, and Sequencing
2.3. Sequence Alignment and Genetic Analyses
3. Results
3.1. Phylogenetic Analysis
3.2. Genetic Population Structure Analysis
3.2.1. Estimation of the Genetic Variability of P. grani with COI
3.2.2. Estimation of the Genetic Variability of P. grani with Cytb
4. Discussion
4.1. Phylogeny of Copepods
4.2. Population Genetic Diversity and Structure of P. grani
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, H.; Hopcroft, R.R.; Bi, H. Statistical Modeling of Copepod Growth Rates: Comparisons for Data Collections Using the Artificial Cohort (AC) Method. J. Exp. Mar. Biol. Ecol. 2013, 448, 271–280. [Google Scholar] [CrossRef]
- Dur, G.; Jiménez-Melero, R.; Beyrend-Dur, D.; Hwang, J.-S.; Souissi, S. Individual-Based Model of the Phenology of Egg-Bearing Copepods: Application to Eurytemora Affinis from the Seine Estuary, France. Ecol. Model. 2013, 269, 21–36. [Google Scholar] [CrossRef]
- Kobbi-Rebai, R.; Annabi-Trabelsi, N.; Khemakhem, H.; Ayadi, H.; Aleya, L. Impacts of Restoration of an Uncontrolled Phosphogypsum Dumpsite on the Seasonal Distribution of Abiotic Variables, Phytoplankton, Copepods, and Ciliates in a Man-Made Solar Saltern. Environ. Monit. Assess. 2013, 185, 2139–2155. [Google Scholar] [CrossRef] [PubMed]
- Ladhar, C.; Tastard, E.; Casse, N.; Denis, F.; Ayadi, H. Strong and Stable Environmental Structuring of the Zooplankton Communities in Interconnected Salt Ponds. Hydrobiologia 2015, 743, 1–13. [Google Scholar] [CrossRef]
- Hotos, G.N. A Preliminary Survey on the Planktonic Biota in a Hypersaline Pond of Messolonghi Saltworks (W. Greece). Diversity 2021, 13, 270. [Google Scholar] [CrossRef]
- Annabi-Trabelsi, N.; Rebai, R.K.; Ali, M.; Subrahmanyam, M.N.V.; Belmonte, G.; Ayadi, H. Egg Production and Hatching Success of Paracartia grani (Copepoda, Calanoida, Acartiidae) in Two Hypersaline Ponds of a Tunisian Solar Saltern. J. Sea Res. 2018, 134, 1–9. [Google Scholar] [CrossRef]
- Ki, J.-S.; Park, H.G.; Lee, J.-S. The Complete Mitochondrial Genome of the Cyclopoid Copepod Paracyclopina Nana: A Highly Divergent Genome with Novel Gene Order and Atypical Gene Numbers. Gene 2009, 435, 13–22. [Google Scholar] [CrossRef]
- Mauchline, J. Adv. Mar. Biol. 33: The Biology of Calanoid Copepods; Academic Press: Cambridge, MA, USA, 1998; ISBN 0-12-026133-2. [Google Scholar]
- Humes, A.G. How Many Copepods? Hydrobiologia 1994, 292–293, 1–7. [Google Scholar] [CrossRef]
- Machida, R.J.; Miya, M.U.; Nishida, M.; Nishida, S. Complete Mitochondrial DNA Sequence of Tigriopus Japonicus (Crustacea: Copepoda). Mar. Biotechnol. 2002, 4, 406–417. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, Y.; Xu, D.; Lou, B.; Guo, Y.; Sun, X.; Guo, B. Genetic Population Structure of Miiuy Croaker (Miichthys miiuy) in the Yellow and East China Seas Base on Mitochondrial COI Sequences. Biochem. Syst. Ecol. 2014, 54, 240–246. [Google Scholar] [CrossRef]
- Böttger-Schnack, R.; Machida, R.J. Comparison of Morphological and Molecular Traits for Species Identification and Taxonomic Grouping of Oncaeid Copepods. Hydrobiologia 2011, 666, 111–125. [Google Scholar] [CrossRef]
- Cepeda, G.D.; Blanco-Bercial, L.; Bucklin, A.; Berón, C.M.; Viñas, M.D. Molecular Systematic of Three Species of Oithona (Copepoda, Cyclopoida) from the Atlantic Ocean: Comparative Analysis Using 28S rDNA. PLoS ONE 2012, 7, e35861. [Google Scholar] [CrossRef]
- Mishler, B.D. The Morphological, Developmental, and Phylogenetic Basis of Species Concepts in Bryophytes. Bryologist 1985, 88, 207–214. [Google Scholar] [CrossRef]
- Jung, S.-O.; Lee, Y.-M.; Park, T.-J.; Park, H.G.; Hagiwara, A.; Leung, K.M.Y.; Dahms, H.-U.; Lee, W.; Lee, J.-S. The Complete Mitochondrial Genome of the Intertidal Copepod Tigriopus sp. (Copepoda, Harpactidae) from Korea and Phylogenetic Considerations. J. Exp. Mar. Biol. Ecol. 2006, 333, 251–262. [Google Scholar] [CrossRef]
- Chullasorn, S.; Kangtia, P.; Song, S.J.; Khim, J.S. Two New Species of Tigriopus Norman, 1869 from Chonburi Province, Thailand (Crustacea: Copepoda: Harpacticidae). Zootaxa 2021, 5051, 41–67. [Google Scholar] [CrossRef]
- Rossel, S.; Martínez Arbizu, P. Revealing Higher than Expected Diversity of Harpacticoida (Crustacea:Copepoda) in the North Sea Using MALDI-TOF MS and Molecular Barcoding. Sci. Rep. 2019, 9, 9182. [Google Scholar] [CrossRef] [PubMed]
- Sepahvand, V.; Shahabi, S. First Molecular Evidence for Two New Associate Copepods of Genus Clausidium Kossmann, 1874 (Copepoda: Cyclopoida: Clausidiidae) from the Persian Gulf and Gulf of Oman. Nauplius 2021, 29, e2021019. [Google Scholar] [CrossRef]
- Radhika, R.; Bijoy Nandan, S.; Harikrishnan, M. Morphological and Molecular Identification of Marine Copepod Dioithona Rigida Giesbrecht, 1896 (Crustacea:Cyclopoida) Based on Mitochondrial COI Gene Sequences, from Lakshadweep Sea, India. Mitochondrial DNA Part A 2017, 28, 872–879. [Google Scholar] [CrossRef] [PubMed]
- Blanco-Bercial, L.; Bradford-Grieve, J.; Bucklin, A. Molecular Phylogeny of the Calanoida (Crustacea: Copepoda). Mol. Phylogenetics Evol. 2011, 59, 103–113. [Google Scholar] [CrossRef]
- Kasapidis, P.; Siokou, I.; Khelifi-Touhami, M.; Mazzocchi, M.G.; Matthaiaki, M.; Christou, E.; Fernandez De Puelles, M.L.; Gubanova, A.; Di Capua, I.; Batziakas, S.; et al. Revising the Taxonomic Status and Distribution of the Paracalanus Parvus Species Complex (Copepoda, Calanoida) in the Mediterranean and Black Seas through an Integrated Analysis of Morphology and Molecular Taxonomy. J. Plankton Res. 2018, 40, 595–605. [Google Scholar] [CrossRef]
- Sukhikh, N.; Abramova, E.; Holl, A.-C.; Souissi, S.; Alekseev, V. A Comparative Analysis of Genetic Differentiation of the E. Affinis Species Complex and Some Other Eurytemora Species, Using the CO1, nITS and 18SrRNA Genes (Copepoda, Calanoida). Crustaceana 2020, 93, 931–955. [Google Scholar] [CrossRef]
- Miyamoto, H.; Machida, R.J.; Nishida, S. Genetic Diversity and Cryptic Speciation of the Deep Sea Chaetognath Caecosagitta Macrocephala (Fowler, 1904). Deep Sea Res. Part II Top. Stud. Oceanogr. 2010, 57, 2211–2219. [Google Scholar] [CrossRef]
- Chen, G.; Hare, M.P. Cryptic Diversity and Comparative Phylogeography of the Estuarine Copepod Acartia Tonsa on the US Atlantic Coast: PHYLOGEOGRAPHY of ACARTIA TONSA. Mol. Ecol. 2011, 20, 2425–2441. [Google Scholar] [CrossRef]
- Wyngaard, G.A.; Hołyńska, M.; Schulte, J.A. Phylogeny of the Freshwater Copepod Mesocyclops (Crustacea: Cyclopidae) Based on Combined Molecular and Morphological Data, with Notes on Biogeography. Mol. Phylogenetics Evol. 2010, 55, 753–764. [Google Scholar] [CrossRef]
- González, C.E.; Goetze, E.; Escribano, R.; Ulloa, O.; Victoriano, P. Genetic Diversity and Novel Lineages in the Cosmopolitan Copepod Pleuromamma Abdominalis in the Southeast Pacific. Sci. Rep. 2020, 10, 1115. [Google Scholar] [CrossRef] [PubMed]
- Bucklin, A.; Frost, B.; Bradford-Grieve, J.; Allen, L.; Copley, N. Molecular Systematic and Phylogenetic Assessment of 34 Calanoid Copepod Species of the Calanidae and Clausocalanidae. Mar. Biol. 2003, 142, 333–343. [Google Scholar] [CrossRef]
- Dippenaar, S.M.; Mathibela, R.B.; Bloomer, P. Cytochrome Oxidase I Sequences Reveal Possible Cryptic Diversity in the Cosmopolitan Symbiotic Copepod Nesippus Orientalis Heller, 1868 (Pandaridae: Siphonostomatoida) on Elasmobranch Hosts from the KwaZulu-Natal Coast of South Africa. Exp. Parasitol. 2010, 125, 42–50. [Google Scholar] [CrossRef]
- Bernot, J.P.; Boxshall, G.A.; Crandall, K.A. A Synthesis Tree of the Copepoda: Integrating Phylogenetic and Taxonomic Data Reveals Multiple Origins of Parasitism. PeerJ 2021, 9, e12034. [Google Scholar] [CrossRef]
- Nawaz, M.A.; Baskar, G.; Meenakshi, S.V.; Saboor, A.; Sivakumar, K. Phylogenetic Relationship of Marine Calanoid Copepods (Crustacea: Maxillopoda) Based on Morphological and Molecular Datasets from the Chennai Coast, Bay of Bengal. Thalassas 2024, 40, 31–42. [Google Scholar] [CrossRef]
- Rose, M. Faune de France. 26 Copépodes Pélagiques; Lechevallier: Paris, France, 1933. [Google Scholar]
- Bradford-Grieve, J. Pelagic Ecosystem Structure and Functioning in the Subtropical Front Region East of New Zealand in Austral Winter and Spring 1993. J. Plankton Res. 1999, 21, 405–428. [Google Scholar] [CrossRef]
- Boxshall, G.A.; Halsey, S.H. An Introduction to Copepod Diversity; Ray Society: London, UK, 2004; ISBN 0-903874-31-8. [Google Scholar]
- Todd, C.D.; Laverack, M.S.; Boxshall, G.A. Coastal Marine Zooplankton: A Practical Manual for Students, 2nd ed.; Cambridge University Press: Cambridge, UK; New York, NY, USA, 1996; ISBN 978-0-521-55533-3. [Google Scholar]
- Böttger-Schnack, R.; Schnack, D. Definition of Species Groups of Oncaeidae (Copepoda: Cyclopoida) as Basis for a Worldwide Identification Key. J. Nat. Hist. 2013, 47, 265–288. [Google Scholar] [CrossRef]
- Razouls, C.; Desreumaux, N.; Kouwenberg, J.; de Bovée, F. Biodiversity of Marine Planktonic Copepods (Morphology, Geographical Distribution and Biological Data); Sorbonne University, CNRS: Paris, France, 2005. [Google Scholar]
- Hermann, D. Caractérisation D’éléments Transposables de Type Mariner Chez Les Microalgues Marines; Université du Maine: Le Mans, France, 2011. [Google Scholar]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA Primers for Amplification of Mitochondrial Cytochrome c Oxidase Subunit I from Diverse Metazoan Invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
- Merritt, T.J.S.; Shi, L.; Chase, M.C.; Rex, M.A.; Etter, R.J.; Quattro, J.M. Universal Cytochrome b Primers Facilitate Intraspecific Studies in Molluscan Taxa. Mol. Mar. Biol. Biotechnol. 1998, 7, 7–11. [Google Scholar] [PubMed]
- Chenna, R. Multiple Sequence Alignment with the Clustal Series of Programs. Nucleic Acids Res. 2003, 31, 3497–3500. [Google Scholar] [CrossRef]
- Schneider, S.; Roessli, D.; Excoffier, L. Arlequin Ver. 2.000. A Software for Population Genetics Data Analysis; Genetics and Biometry Laboratory, University of Geneva: Geneva, Switzerland, 2000. [Google Scholar]
- Schwentner, M.; Timms, B.V.; Bastrop, R.; Richter, S. Phylogeny of Spinicaudata (Branchiopoda, Crustacea) Based on Three Molecular Markers—An Australian Origin for Limnadopsis. Mol. Phylogenetics Evol. 2009, 53, 716–725. [Google Scholar] [CrossRef]
- Williams, S.T.; Donald, K.M.; Spencer, H.G.; Nakano, T. Molecular Systematics of the Marine Gastropod Families Trochidae and Calliostomatidae (Mollusca: Superfamily Trochoidea). Mol. Phylogenetics Evol. 2010, 54, 783–809. [Google Scholar] [CrossRef]
- Sabroux, R.; Corbari, L.; Hassanin, A. Phylogeny of Sea Spiders (Arthropoda: Pycnogonida) Inferred from Mitochondrial Genome and 18S Ribosomal RNA Gene Sequences. Mol. Phylogenetics Evol. 2023, 182, 107726. [Google Scholar] [CrossRef]
- Watanabe, T.; Hirai, J.; Sildever, S.; Tadokoro, K.; Hidaka, K.; Tanita, I.; Nishiuchi, K.; Iguchi, N.; Kasai, H.; Nishi, N.; et al. Improving Taxonomic Classification of Marine Zooplankton by Molecular Approach: Registration of Taxonomically Verified 18S and 28S rRNA Gene Sequences. PeerJ 2023, 11, e15427. [Google Scholar] [CrossRef]
- Laakmann, S.; Auel, H.; Kochzius, M. Evolution in the Deep Sea: Biological Traits, Ecology and Phylogenetics of Pelagic Copepods. Mol. Phylogenetics Evol. 2012, 65, 535–546. [Google Scholar] [CrossRef]
- Questel, J.M.; Hopcroft, R.R.; DeHart, H.M.; Smoot, C.A.; Kosobokova, K.N.; Bucklin, A. Metabarcoding of Zooplankton Diversity within the Chukchi Borderland, Arctic Ocean: Improved Resolution from Multi-Gene Markers and Region-Specific DNA Databases. Mar. Biodivers. 2021, 51, 4. [Google Scholar] [CrossRef]
- Wu, S.; Xiong, J.; Yu, Y. Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda. PLoS ONE 2015, 10, e0131498. [Google Scholar] [CrossRef] [PubMed]
- Matthews, S.A.; Goetze, E.; Ohman, M.D. Recommendations for Interpreting Zooplankton Metabarcoding and Integrating Molecular Methods with Morphological Analyses. ICES J. Mar. Sci. 2021, 78, 3387–3396. [Google Scholar] [CrossRef]
- Minxiao, W.; Song, S.; Chaolun, L.; Xin, S. Distinctive Mitochondrial Genome of Calanoid Copepod Calanus Sinicus with Multiple Large Non-Coding Regions and Reshuffled Gene Order: Useful Molecular Markers for Phylogenetic and Population Studies. BMC Genom. 2011, 12, 73. [Google Scholar] [CrossRef] [PubMed]
- Machida, R.J.; Miya, M.U.; Nishida, M.; Nishida, S. Molecular Phylogeny and Evolution of the Pelagic Copepod Genus Neocalanus (Crustacea: Copepoda). Mar. Biol. 2006, 148, 1071–1079. [Google Scholar] [CrossRef]
- Cornils, A.; Held, C. Evidence of Cryptic and Pseudocryptic Speciation in the Paracalanus Parvus Species Complex (Crustacea, Copepoda, Calanoida). Front. Zool. 2014, 11, 19. [Google Scholar] [CrossRef]
- Khodami, S.; Mercado-Salas, N.F.; Tang, D.; Martinez Arbizu, P. Molecular Evidence for the Retention of the Thaumatopsyllidae in the Order Cyclopoida (Copepoda) and Establishment of Four Suborders and Two Families within the Cyclopoida. Mol. Phylogenetics Evol. 2019, 138, 43–52. [Google Scholar] [CrossRef]
- Adamowicz, S.J.; Menu-Marque, S.; Halse, S.A.; Topan, J.C.; Zemlak, T.S.; Hebert, P.D.N.; Witt, J.D.S. The Evolutionary Diversification of the Centropagidae (Crustacea, Calanoida): A History of Habitat Shifts. Mol. Phylogenetics Evol. 2010, 55, 418–430. [Google Scholar] [CrossRef] [PubMed]
- Bradford-Grieve, J.M.; Boxshall, G.A.; Ahyong, S.T.; Ohtsuka, S. Cladistic Analysis of the Calanoid Copepoda. Invertebr. Syst. 2010, 24, 291. [Google Scholar] [CrossRef]
- Huys, R.; Mackenzie-Dodds, J.; Llewellyn-Hughes, J. Cancrincolidae (Copepoda, Harpacticoida) Associated with Land Crabs: A Semiterrestrial Leaf of the Ameirid Tree. Mol. Phylogenetics Evol. 2009, 51, 143–156. [Google Scholar] [CrossRef]
- Ki, J.-S.; Park, H.G.; Lee, J.-S. Extensive Analysis of Nuclear Cistron rDNA Sequence of Paracyclopina Nana (Cyclopoida: Cyclopettidae). Hydrobiologia 2011, 666, 3–9. [Google Scholar] [CrossRef]
- Avise, J.C. Phylogeography: The History and Formation of Species; Harvard University Press: Cambridge, MA, USA, 2000; ISBN 0-674-66638-0. [Google Scholar]
- Song, J.; Hou, F.; Zhang, X.; Yue, B.; Song, Z. Mitochondrial Genetic Diversity and Population Structure of a Vulnerable Freshwater Fish, Rock Carp (Procypris Rabaudi) in Upper Yangtze River Drainage. Biochem. Syst. Ecol. 2014, 55, 1–9. [Google Scholar] [CrossRef]
- Bu, X.; Liu, L.; Nie, L. Genetic Diversity and Population Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus Sinensis) in Three Geographical Populations. Biochem. Syst. Ecol. 2014, 54, 279–284. [Google Scholar] [CrossRef]
- Bucklin, A. Population Genetics of Drifting (Calanus Spp.) and Resident (Acartia Clausi) Plankton in Norwegian Fjords. J. Plankton Res. 2000, 22, 1237–1251. [Google Scholar] [CrossRef]
- Makino, W.; Knox, M.A.; Duggan, I.C. Invasion, Genetic Variation and Species Identity of the Calanoid Copepod Sinodiaptomus Valkanovi. Freshw. Biol. 2010, 55, 375–386. [Google Scholar] [CrossRef]
- Hartl, D.L.; Clark, A.G.; Clark, A.G. Principles of Population Genetics; Sinauer Associates: Sunderland, MA, USA, 1997; Volume 116. [Google Scholar]
- Pannacciulli, F.G.; Manetti, G.; Maltagliati, F. Genetic Diversity in Two Barnacle Species, Chthamalus Stellatus and Tesseropora Atlantica (Crustacea, Cirripedia), with Different Larval Dispersal Modes in the Archipelago of the Azores. Mar. Biol. 2009, 156, 2441–2450. [Google Scholar] [CrossRef]
- Unal, E.; Bucklin, A. Basin-Scale Population Genetic Structure of the Planktonic Copepod Calanus Finmarchicus in the North Atlantic Ocean. Prog. Oceanogr. 2010, 87, 175–185. [Google Scholar] [CrossRef]
- De Aranzamendi, M.C.; Bastida, R.; Gardenal, C.N. Genetic Population Structure in Nacella Magellanica: Evidence of Rapid Range Expansion throughout the Entire Species Distribution on the Atlantic Coast. J. Exp. Mar. Biol. Ecol. 2014, 460, 53–61. [Google Scholar] [CrossRef]
- Zlojutro, M.; Rubicz, R.; Devor, E.J.; Spitsyn, V.A.; Makarov, S.V.; Wilson, K.; Crawford, M.H. Genetic Structure of the Aleuts and Circumpolar Populations Based on Mitochondrial DNA Sequences: A Synthesis. Am. J. Phys. Anthr. 2006, 129, 446–464. [Google Scholar] [CrossRef]
- Grosberg, R.; Cunningham, C.W. Genetic Structure in the Sea: From Populations to Communities. In Marine Community Ecology; Sinauer Associates: Sunderland, MA, USA, 2001; pp. 61–84. [Google Scholar]
- Wares, J.P.; Gaines, S.D.; Cunningham, C.W. A Comparative Study of Asymmetric Migration Events across a Marine Biogeographic Boundary. Evolution 2001, 55, 295–306. [Google Scholar] [CrossRef]
Gene | Primer Name, Sequence | Size (bp) | AT (°C) |
---|---|---|---|
18S | Rib1 (F), GGGGGAGTATGGTCGCAAGGC [37] | ~400 | 60 |
Rib2 (R), TCAGTGTAGCGCGCGTGCGGC [37] | |||
COI | LCO1490 (F), GGTCAACAAATCATAAAGATATTGG [38] | ~650 | 40 |
HCO2198 (R), TAAACTTCAGGGTGACCAAAAAATCA [38] | |||
Cytb | UCYTB151F, TGTGGRGCNACYGTWATYACTAA [39] | ~400 | 42 |
UCYTB270R, AANAGGAARTAYCAYTCNGGYTG [39] |
Ordre | Species | Localization | Accession Numbers in GenBank |
---|---|---|---|
Calanoida | Acartia longiremis | Sweden | GU969156 |
Acartia pacifica | Not defined | GU969157 | |
Acartia negligens | Not defined | GU969198 | |
Acartia danae | Not defined | GU969197 | |
Acartia hongi | Not defined | GU969195 | |
Acartia omorii | Not defined | GU969196 | |
Acartia tonsa 1 | USA | GU350740 | |
Acartia tonsa 2 | USA | GU350741 | |
Acartia tonsa 3 | USA | FJ422281 | |
Cyclopoida | Oithona sp. 1 | USA | GU594643 |
Oithona sp. 2 | New Caledonia | JF781540 | |
Oithona sp. 3 | New Caledonia | JF781539 | |
Oithona nana | Brazil | HQ008734 | |
Paracyclopina nana | Korea | FJ214952 | |
Oithona simplex | Brazil | HQ008735 | |
Oithona hebes | Brazil | HQ008733 | |
Dioithona oculata | Belize | HQ008732 | |
Oithona similis | Not defined | GU969179 | |
Harpacticoida | Nitocra sp. | Not defined | JX438707 |
Attheyella crassa | England | EU380307 | |
Itunella muelleri | Iceland | EU380309 | |
Mesochra rapiens | Sweden | EU380308 | |
Tisbe sp. | USA | FJ713566 |
Order | Species | Sampling Ponds | Individual Number |
---|---|---|---|
Cyclopoida | Oithona similis | A5 | 3 |
Oithona nana | A5 | 5 | |
Calanoida | Paracartia grani | A16 | 4 |
Harpacticoida | Clytemnestra scutellata | A5 | 3 |
P. grani | ||||||
---|---|---|---|---|---|---|
COI | Cytb | |||||
A5 | A16 | A5 and A16 | A5 | A16 | A5 and A16 | |
N | 20 | 26 | 46 | 9 | 14 | 23 |
Nhap | 12 | 11 | 21 | 9 | 14 | 23 |
Nsipol | 42 | 25 | 52 | 27 | 39 | 46 |
Hd | 0.0500 | 0.0385 | 0.0217 | 0.111 | 0.0714 | 0.0435 |
π | 0.0122 | 0.0076 | 0.0096 | 0.0277 | 0.0283 | 0.0293 |
Pd | 7.921 | 5.092 | 6.311 | 11.306 | 12.923 | 12.545 |
Fst | 0 | 0.04007 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ladhar, C.; Denis, F.; Guermazi, W.; Annabi-Trabelsi, N.; Casse, N.; Ayadi, H.; Hotos, G.N. Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences. Diversity 2024, 16, 751. https://doi.org/10.3390/d16120751
Ladhar C, Denis F, Guermazi W, Annabi-Trabelsi N, Casse N, Ayadi H, Hotos GN. Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences. Diversity. 2024; 16(12):751. https://doi.org/10.3390/d16120751
Chicago/Turabian StyleLadhar, Chiraz, Françoise Denis, Wassim Guermazi, Neila Annabi-Trabelsi, Nathalie Casse, Habib Ayadi, and George N. Hotos. 2024. "Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences" Diversity 16, no. 12: 751. https://doi.org/10.3390/d16120751
APA StyleLadhar, C., Denis, F., Guermazi, W., Annabi-Trabelsi, N., Casse, N., Ayadi, H., & Hotos, G. N. (2024). Phylogeny and Genetic Population Structure of Dominant Copepods in Two Ponds with Contrasting Salinities in the Solar Saltern of Sfax (Tunisia) Based on Mitochondrial (COI and Cytb) and Nuclear (18S) DNA Sequences. Diversity, 16(12), 751. https://doi.org/10.3390/d16120751