U11/U12 Small Nuclear Ribonucleoprotein TaU11/U12-35K Interacts with TaHis and Negatively Contributes to Fusarium Head Blight Resistance in Wheat
Abstract
1. Introduction
2. Results
2.1. Identification of the TaU11/U12-35K Gene
2.2. Y2H Validation of TaHis-TaU11/U12-35K
2.3. BiFC Validation of TaHis-TaU11/U12-35K Interaction
2.4. Silencing of TaU11/U12-35K Enhances Wheat FHB Resistance
2.5. Differential Expression of TaU11/U12-35K Gene in Resistant and Susceptible Wheat
3. Discussion
4. Materials and Methods
4.1. Plant and Fungal Materials
4.2. Wheat RNA Extraction, cDNA Synthesis, and Gene Amplification
4.3. Yeast Two-Hybrid (Y2H) Interaction Validation
4.4. Bimolecular Fluorescence Complementation (BiFC) Assay
4.5. Functional Validation of TaU11/U12-35K Gene Using BSMV-VIGS
4.6. Analysis of TaU11/U12-35K Gene Expression Pattern Induced by FHB
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Su, P.S. Research Advances in Wheat FHB Resistance Mechanism. Curr. Biotechnol. 2021, 11, 599–609. [Google Scholar]
- Xu, M.; Wang, Q.; Wang, G.; Zhang, X.; Liu, H.; Jiang, C. Combatting Fusarium head blight: Advances in molecular interactions between Fusarium graminearum and wheat. Phytopathol. Res. 2022, 4, 37. [Google Scholar] [CrossRef]
- Hafeez, A.N.; Arora, S.; Ghosh, S.; Gilbert, D.; Bowden, R.L.; Wulff, B.B. Creation and judicious application of a wheat resistance gene atlas. Mol. Plant 2021, 14, 1053–1070. [Google Scholar] [CrossRef]
- Ma, Z.; Xie, Q.; Li, G.; Jia, H.; Zhou, J.; Kong, Z.; Li, N.; Yuan, Y. Germplasms, genetics and genomics for better control of disastrous wheat Fusarium head blight. Theor. Appl. Genet. 2020, 133, 1541–1568. [Google Scholar] [CrossRef]
- Johns, L.E.; Bebber, D.P.; Gurr, S.J.; Brown, N.A. Emerging health threat and cost of Fusarium mycotoxins in European wheat. Nat. Food 2022, 3, 1014–1019. [Google Scholar] [CrossRef] [PubMed]
- Bai, G.H.; Desjardins, A.E.; Plattner, R.D. Deoxynivalenol-nonproducing Fusarium graminearum causes initial infection, but does not cause disease spread in wheat spikes. Mycopathologia 2002, 153, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Maier, F.J.; Miedaner, T.; Hadeler, B.; Felk, A.; Salomon, S.; Lemmens, M.; Kassner, H.; Schäfer, W. Involvement of trichothecenes in fusarioses of wheat, barley and maize evaluated by gene disruption of the trichodiene synthase (Tri5) gene in three field isolates of different chemotype and virulence. Mol. Plant Pathol. 2006, 7, 449–461. [Google Scholar] [CrossRef]
- Jansen, C.; von Wettstein, D.; Schäfer, W.; Kogel, K.-H.; Felk, A.; Maier, F.J. Infection patterns in barley and wheat spikes inoculated with wild-type and trichodiene synthase gene disrupted Fusarium graminearum. Proc. Natl. Acad. Sci. USA 2005, 102, 16892–16897. [Google Scholar] [CrossRef]
- Bönnighausen, J.; Schauer, N.; Schäfer, W.; Bormann, J. Metabolic profiling of wheat rachis node infection by Fusarium graminearum—Decoding deoxynivalenol-dependent susceptibility. New Phytol. 2019, 221, 459–469. [Google Scholar] [CrossRef]
- Zhang, Y.; Yang, Z.; Ma, H.; Huang, L.; Ding, F.; Du, Y.; Jia, H.; Li, G.; Kong, Z.; Ran, C.; et al. Pyramiding of Fusarium Head Blight Resistance Quantitative Trait Loci, Fhb1, Fhb4, and Fhb5, in Modern Chinese Wheat Cultivars. Front. Plant Sci. 2021, 12, 694023. [Google Scholar] [CrossRef]
- Li, G.; Zhou, J.; Jia, H.; Gao, Z.; Fan, M.; Luo, Y.; Zhao, P.; Xue, S.; Li, N.; Yuan, Y.; et al. Mutation of a histidine-rich calcium-binding–protein gene in wheat confers resistance to Fusarium head blight. Nat. Genet. 2019, 51, 1106–1112. [Google Scholar] [CrossRef] [PubMed]
- Su, Z.; Bernardo, A.; Tian, B.; Chen, H.; Wang, S.; Ma, H.; Cai, S.; Liu, D.; Zhang, D.; Li, T.; et al. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat. Genet. 2019, 51, 1099–1105. [Google Scholar] [CrossRef]
- Chen, H.; Su, Z.; Tian, B.; Hao, G.; Trick, H.N.; Bai, G. TaHRC suppresses the calcium-mediated immune response and triggers wheat Fusarium head blight susceptibility. Plant Physiol. 2022, 190, 1566–1569. [Google Scholar] [CrossRef]
- He, Y.; Yang, X.; Xia, X.; Wang, Y.; Dong, Y.; Wu, L.; Jiang, P.; Zhang, X.; Jiang, C.; Ma, H.; et al. A phase-separated protein hub modulates resistance to Fusarium head blight in wheat. Cell Host Microbe 2024, 32, 710–726.e10. [Google Scholar] [CrossRef]
- Chaudhary, S.; Jabre, I.; Reddy, A.S.; Staiger, D.; Syed, N.H. Perspective on Alternative Splicing and Proteome Complexity in Plants. Trends Plant Sci. 2019, 24, 496–506. [Google Scholar] [CrossRef]
- Pan, Q.; Shai, O.; Lee, L.J.; Frey, B.J.; Blencowe, B.J. Deep surveying of alternative splicing complexity in the human transcriptome by high-throughput sequencing. Nat. Genet. 2008, 40, 1413–1415, Addendum in Nat. Genet. 2009, 41, 762. [Google Scholar] [CrossRef]
- Marquez, Y.; Brown, J.W.; Simpson, C.; Barta, A.; Kalyna, M. Transcriptome survey reveals increased complexity of the alternative splicing landscape in Arabidopsis. Genome Res. 2012, 22, 1184–1195. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Guo, W.; Chen, J.; Sun, Z. Decoding alternative splicing: A key player in plant biotic stress resistance. J. Integr. Plant Biol. 2025; in press. [Google Scholar] [CrossRef]
- Sun, B.; Huang, J.; Kong, L.; Gao, C.; Zhao, F.; Shen, J.; Wang, T.; Li, K.; Wang, L.; Wang, Y.; et al. Alternative splicing of a potato disease resistance gene maintains homeostasis between growth and immunity. Plant Cell 2024, 36, 3729–3750. [Google Scholar] [CrossRef]
- Huang, J.; Lu, X.; Wu, H.; Xie, Y.; Peng, Q.; Gu, L.; Wu, J.; Wang, Y.; Reddy, A.S.; Dong, S. Phytophthora Effectors Modulate Genome-wide Alternative Splicing of Host mRNAs to Reprogram Plant Immunity. Mol. Plant 2020, 13, 1470–1484. [Google Scholar] [CrossRef]
- Huang, J.; Gu, L.; Zhang, Y.; Yan, T.; Kong, G.; Kong, L.; Guo, B.; Qiu, M.; Wang, Y.; Jing, M.; et al. An oomycete plant pathogen reprograms host pre-mRNA splicing to subvert immunity. Nat. Commun. 2017, 8, 2051. [Google Scholar] [CrossRef]
- Lorković, Z.J.; Lehner, R.; Forstner, C.; Barta, A. Evolutionary conservation of minor U12-type spliceosome between plants and humans. RNA 2005, 11, 1095–1107. [Google Scholar] [CrossRef]
- Buerstmayr, H.; Lemmens, M.; Hartl, L.; Doldi, L.; Steiner, B.; Stierschneider, M.; Ruckenbauer, P. Molecular mapping of QTLs for Fusarium head blight resistance in spring wheat. I. Resistance to fungal spread (Type II resistance). Theor. Appl. Genet. 2002, 104, 84–91. [Google Scholar] [CrossRef]
- Song, P.W.; Deng, J.L.; Du, Y.X.; Chen, J.M.; Jing, Y.T.; Liu, J.T.; Li, A.; Hu, H.Y. Interaction identification between wheat mRNA splicing factor TaSR and TaHis and their gene expression analysis. Acta Agric. Boreali-Sin. 2024, 39, 166–172. [Google Scholar]
- Zhang, Y.; Dhaliwal, S.; Bamforth, J.; Kurera, S.; Abbasi, M.; Holden, S.; Fetterley, V.; Alfonso, A.S.; Bamrah, R.; Walkowiak, S.; et al. First report of Fusarium graminearum causing Fusarium head blight of wheat and barley in the Lower Mainland of British Columbia, Canada. Plant Dis. 2023, 107, 2531. [Google Scholar] [CrossRef]





| Primer Name | Primer Sequence (5′—3′) |
|---|---|
| TaU11/U12-35K-F TaU11/U12-35K-R TaHis-F TaHis-R AD-TaU11/U12-35K-F AD-TaU11/U12-35K-R BD-TaHis-F BD-TaHis-R BIFC-TaU11/U12-35K-F BIFC-TaU11/U12-35K-R BIFC-TaHis-F BIFC-TaHis-R BSMV-TaU11/U12-35K-F BSMV-TaU11/U12-35K-R qTubulin-F qTubulin-R qActin-F qActin-R qTaU11/U12-35K-F qTaU11/U12-35K-R | ATGAGGGTCGGCGTCG CCTCTGCTCCCGATGAG ATCTGTATATTTGGACAACCATGTA TTACACGAGTTGCTTCCCGT GGAGGCCAGTGAATTCATGAGAGTCGGCGTCGGCGGGA CGAGCTCGATGGATCCTTACTGGCTATAATCTCGGCTC CATGGAGGCCGAATTCATGTCTATATTTGGACAACCATGTA GCAGGTCGACGGATCCTTACACGAGTTCCTTCCCGT GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATGAGGGTCGGCGTCGGCG GGGGACCACTTTGTACAAGAAAGCTGGGTC CCTCTGCTCCCGATGAGAT GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGTGTATATTTGGACAACCATGTA GGGGACCACTTTGTACAAGAAAGCTGGGTCCACGAGTTGCTTCCCGTC TAGCTGATTAATTAACCCGGG AACTGAAGACGACGCAGGTC TAGCTGAGCGGCCGCCCCGGG TACCTCTGCTCCCGATGAGAT ATCTCCAACTCCACCAGTGTCG TCATCGCCCTCATCACCGTC TGACCGTATGAGCAAGGAG CCAGACAACTCGCAACTTAG CTAGGAGGAGGACTTGGAGGAA CAAAACGTGTCATATACCGCCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Song, P.; Li, A.; Deng, J.; Li, D.; Hu, P.; Guan, Y.; Zhang, M.; Liu, Q.; Hu, H.; Ru, Z. U11/U12 Small Nuclear Ribonucleoprotein TaU11/U12-35K Interacts with TaHis and Negatively Contributes to Fusarium Head Blight Resistance in Wheat. Int. J. Mol. Sci. 2025, 26, 8288. https://doi.org/10.3390/ijms26178288
Song P, Li A, Deng J, Li D, Hu P, Guan Y, Zhang M, Liu Q, Hu H, Ru Z. U11/U12 Small Nuclear Ribonucleoprotein TaU11/U12-35K Interacts with TaHis and Negatively Contributes to Fusarium Head Blight Resistance in Wheat. International Journal of Molecular Sciences. 2025; 26(17):8288. https://doi.org/10.3390/ijms26178288
Chicago/Turabian StyleSong, Puwen, Ao Li, Jiale Deng, Dan Li, Ping Hu, Yuanyuan Guan, Meng Zhang, Qili Liu, Haiyan Hu, and Zhengang Ru. 2025. "U11/U12 Small Nuclear Ribonucleoprotein TaU11/U12-35K Interacts with TaHis and Negatively Contributes to Fusarium Head Blight Resistance in Wheat" International Journal of Molecular Sciences 26, no. 17: 8288. https://doi.org/10.3390/ijms26178288
APA StyleSong, P., Li, A., Deng, J., Li, D., Hu, P., Guan, Y., Zhang, M., Liu, Q., Hu, H., & Ru, Z. (2025). U11/U12 Small Nuclear Ribonucleoprotein TaU11/U12-35K Interacts with TaHis and Negatively Contributes to Fusarium Head Blight Resistance in Wheat. International Journal of Molecular Sciences, 26(17), 8288. https://doi.org/10.3390/ijms26178288

