Amaryllidaceae Alkaloids and Phenolic Acids Identification in Leucojum aestivum L. Plant Cultures Exposed to Different Temperature Conditions
Abstract
1. Introduction
2. Results and Discussion
2.1. Effect of Temperature on In Vitro Plant Growth
2.2. Effect of Temperature on Photosynthetic Pigment Content
2.3. Effect of Temperature on Soluble Sugar Content
2.4. Effect of Temperature on Antioxidant Enzyme Activity
2.5. Effect of Temperature on Phenolic Acids Biosynthesis
2.6. Effect of Temperature on Amaryllidaceae Alkaloid Biosynthesis
2.7. Effect of Temperature on Expression of Amaryllidaceae Alkaloid Biosynthesis Pathway Genes in L. aestivum In Vitro Plants
3. Materials and Methods
3.1. In Vitro Experimental Cultures
3.2. Determination of Photosynthetic Pigments
3.3. Determination of Soluble Sugars
3.4. Antioxidant Enzyme Activity Analysis
3.5. Phenolic Acid Analysis
3.6. Amaryllidaceae Alkaloid Analyses
3.7. Gene Expression Analysis
| Gene | Primer Sequence Forward/Revers (F/R) (5′–3′) | Source and Species |
|---|---|---|
| PAL | F: CAAAGTGCAGAGCAACATAATCAAG | [58] Lycoris longituba |
| R: TTCACTGTGCTCTTCAAATTCTCC | ||
| C4H | F: GTCAGAGGAATCTCGTAGTCGTGTC | [58] Lycoris longituba |
| R: CTCACCGTACACTGTAAAGACCATG | ||
| C3H | F: CAGGTGCTTCGCCGAGTGG | [58] Lycoris longituba |
| R: CCTCACCTTCACGTAGTGGG | ||
| TYDC1 | F: TGGTTTTAATATTGTGGGTTTCAAT | [97] Narcissus pseudonarcissus |
| R: TTCACTAGCTGTGCCTTGAATTACT | ||
| TYDC2 | F: GTAATTCAAGGCACAGCTAGTGAAG | [97] Narcissus pseudonarcissus |
| R: ATAAACCACAAGCTTTTCAAGTGAT | ||
| LaNBS | F: AACGGGATCCATGAAGGGAAGTCTCTCCCATGAG | [82] Leucojum aestivum |
| R: ACGCAAGCTTCTACGCTACAATAGCTTTTTGCTCC | ||
| LaN4OMT | F: GGTGCTAGCCAAGATGATTA | NCBI: MW971978/ Leucojum aestivum |
| R: CGTCGACAAATAGTCACTCC | ||
| OMT | F: AAGCTTGTCAGGGTTGGAGG | [58] Lycoris longituba |
| R: TACACTCCTCCTCTTCCGGA | ||
| LaCYP96T1 | F: GCTCCGCTAGATCTTCAAGC | NCBI: MW971979/ Leucojum aestivum |
| R: AGCTTTCGCGAATGGTACGG | ||
| CYP96T1 | F: TGCTATGGCGAGGATGAAGG | [58] Lycoris longituba |
| R: ACATGTCCCTTCACCATCTG | ||
| Actin | F: GATAGAACCTCCAATCCAAACACTA | [97] Narcissus pseudonarcissus |
| R: GTGTGATGTGGATATTAGGAAGGAC |
3.8. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Berkov, S.; Sidjimova, B.; Evstatieva, L.; Popov, S. Intraspecific Variability in the Alkaloid Metabolism of Galanthus elwesii. Phytochemistry 2004, 65, 579–586. [Google Scholar] [CrossRef] [Scilit]
- Heinrich, M.; Lee Teoh, H. Galanthamine from Snowdrop—The Development of a Modern Drug against Alzheimer’s Disease from Local Caucasian Knowledge. J. Ethnopharmacol. 2004, 92, 147–162. [Google Scholar] [CrossRef] [PubMed]
- Houghton, P.J.; Ren, Y.; Howes, M.-J. Acetylcholinesterase Inhibitors from Plants and Fungi. Nat. Prod. Rep. 2006, 23, 181–199. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cimmino, A.; Masi, M.; Evidente, M.; Superchi, S.; Evidente, A. Amaryllidaceae Alkaloids: Absolute Configuration and Biological Activity. Chirality 2017, 29, 486–499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roy, M.; Liang, L.; Xiao, X.; Feng, P.; Ye, M.; Liu, J. Lycorine: A Prospective Natural Lead for Anticancer Drug Discovery. Biomed. Pharmacother. 2018, 107, 615–624. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.-M.; Li, T.; Xu, C.-C.; Qian, J.-Y.; Guo, H.; Zhang, X.; Zhan, Z.-J.; Lu, J.-J. Uncover the Anticancer Potential of Lycorine. Chin. Med. 2024, 19, 121. [Google Scholar] [CrossRef] [Scilit]
- Jin, Y.-H.; Min, J.S.; Jeon, S.; Lee, J.; Kim, S.; Park, T.; Park, D.; Jang, M.S.; Park, C.M.; Song, J.H.; et al. Lycorine, a Non-Nucleoside RNA Dependent RNA Polymerase Inhibitor, as Potential Treatment for Emerging Coronavirus Infections. Phytomedicine 2021, 86, 153440. [Google Scholar] [CrossRef] [Scilit]
- Szlávik, L.; Gyuris, A.; Minárovits, J.; Forgo, P.; Molnár, J.; Hohmann, J. Alkaloids from Leucojum vernum and Antiretroviral Activity of Amaryllidaceae Alkaloids. Planta Med. 2004, 70, 871–873. [Google Scholar] [CrossRef] [Scilit]
- da Silva, A.F.S.; de Andrade, J.P.; Bevilaqua, L.R.M.; de Souza, M.M.; Izquierdo, I.; Henriques, A.T.; Zuanazzi, J.A.S. Anxiolytic-, Antidepressant- and Anticonvulsant-like Effects of the Alkaloid Montanine Isolated from Hippeastrum vittatum. Pharmacol. Biochem. Behav. 2006, 85, 148–154. [Google Scholar] [CrossRef] [Scilit]
- Van Goietsenoven, G.; Andolfi, A.; Lallemand, B.; Cimmino, A.; Lamoral-Theys, D.; Gras, T.; Abou-Donia, A.; Dubois, J.; Lefranc, F.; Mathieu, V.; et al. Amaryllidaceae Alkaloids Belonging to Different Structural Subgroups Display Activity against Apoptosis-Resistant Cancer Cells. J. Nat. Prod. 2010, 73, 1223–1227. [Google Scholar] [CrossRef] [Scilit]
- He, M.; Qu, C.; Gao, O.; Hu, X.; Hong, X. Biological and Pharmacological Activities of Amaryllidaceae Alkaloids. RSC Adv. 2015, 5, 16562–16574. [Google Scholar] [CrossRef] [Scilit]
- Qiao, S.; Yao, J.; Wang, Q.; Li, L.; Wang, B.; Feng, X.; Wang, Z.; Yin, M.; Chen, Y.; Xu, S. Antifungal Effects of Amaryllidaceous Alkaloids from Bulbs of Lycoris spp. against Magnaporthe oryzae. Pest Manag. Sci. 2023, 79, 2423–2432. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ka, S.; Koirala, M.; Mérindol, N.; Desgagné-Penix, I. Biosynthesis and Biological Activities of Newly Discovered Amaryllidaceae Alkaloids. Molecules 2020, 25, 4901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mucke, H.A. The Case of Galantamine: Repurposing and Late Blooming of a Cholinergic Drug. Future Sci. OA 2015, 1, FSO73. [Google Scholar] [CrossRef] [Scilit]
- Czollner, L.; Frantsits, W.; Küenburg, B.; Hedenig, U.; Fröhlich, J.; Jordis, U. New Kilogram-Synthesis of the Anti-Alzheimer Drug (−)-Galanthamine. Tetrahedron Lett. 1998, 39, 2087–2088. [Google Scholar] [CrossRef] [Scilit]
- Guillou, C.; Beunard, J.-L.; Gras, E.; Thal, C. An Efficient Total Synthesis of (±)-Galanthamine. Angew. Chem. Int. Ed. 2001, 40, 4745–4746. [Google Scholar] [CrossRef] [Scilit]
- Stanilova, M.I.; Molle, E.D.; Yanev, S.G. Galanthamine Production by Leucojum aestivum Cultures in Vitro. Alkaloids Chem. Biol. 2010, 68, 167–270. [Google Scholar] [CrossRef] [Scilit]
- Laurain-Mattar, D.; Ptak, A. Amaryllidaceae Alkaloid Accumulation by Plant In Vitro Systems. In Bioprocessing of Plant In Vitro Systems; Springer: Cham, Switzerland, 2018; pp. 203–223. ISBN 978-3-319-54600-1. [Google Scholar]
- Georgiev, V.; Ivanov, I.; Pavlov, A. Recent Progress in Amaryllidaceae Biotechnology. Molecules 2020, 25, 4670. [Google Scholar] [CrossRef] [Scilit]
- Kaur, H.; Chahal, S.; Jha, P.; Lekhak, M.M.; Shekhawat, M.S.; Naidoo, D.; Arencibia, A.D.; Ochatt, S.J.; Kumar, V. Harnessing Plant Biotechnology-Based Strategies for in Vitro Galanthamine (GAL) Biosynthesis: A Potent Drug against Alzheimer’s Disease. Plant Cell Tissue Organ Cult. PCTOC 2022, 149, 81–103. [Google Scholar] [CrossRef] [Scilit]
- Koirala, M.; Karimzadegan, V.; Liyanage, N.S.; Mérindol, N.; Desgagné-Penix, I. Biotechnological Approaches to Optimize the Production of Amaryllidaceae Alkaloids. Biomolecules 2022, 12, 893. [Google Scholar] [CrossRef] [Scilit]
- Ptak, A.; Morańska, E.; Saliba, S.; Zieliński, A.; Simlat, M.; Laurain-Mattar, D. Elicitation of Galanthamine and Lycorine Biosynthesis by Leucojum aestivum L. and L. aestivum ‘Gravety Giant’ Plants Cultured in Bioreactor RITA®. Plant Cell Tissue Organ Cult. PCTOC 2017, 128, 335–345. [Google Scholar] [CrossRef] [Scilit]
- Ptak, A.; Simlat, M.; Morańska, E.; Skrzypek, E.; Warchoł, M.; Tarakemeh, A.; Laurain-Mattar, D. Exogenous Melatonin Stimulated Amaryllidaceae Alkaloid Biosynthesis in in Vitro Cultures of Leucojum aestivum L. Ind. Crops Prod. 2019, 138, 111458. [Google Scholar] [CrossRef] [Scilit]
- Ptak, A.; Morańska, E.; Skrzypek, E.; Warchoł, M.; Spina, R.; Laurain-Mattar, D.; Simlat, M. Carbohydrates Stimulated Amaryllidaceae Alkaloids Biosynthesis in Leucojum aestivum L. Plants Cultured in RITA® Bioreactor. PeerJ 2020, 8, e8688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ptak, A.; Morańska, E.; Warchoł, M.; Gurgul, A.; Skrzypek, E.; Dziurka, M.; Laurain-Mattar, D.; Spina, R.; Jaglarz, A.; Simlat, M. Endophytic Bacteria from in Vitro Culture of Leucojum aestivum L. a New Source of Galanthamine and Elicitor of Alkaloid Biosynthesis. Sci. Rep. 2022, 12, 13700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morańska, E.; Simlat, M.; Warchoł, M.; Skrzypek, E.; Waligórski, P.; Laurain-Mattar, D.; Spina, R.; Ptak, A. Phenolic Acids and Amaryllidaceae Alkaloids Profiles in Leucojum aestivum L. In Vitro Plants Grown under Different Light Conditions. Molecules 2023, 28, 1525. [Google Scholar] [CrossRef] [Scilit]
- Saini, N.; Anmol, A.; Kumar, S.; Wani, A.W.; Bakshi, M.; Dhiman, Z. Exploring Phenolic Compounds as Natural Stress Alleviators in Plants—A Comprehensive Review. Physiol. Mol. Plant Pathol. 2024, 133, 102383. [Google Scholar] [CrossRef] [Scilit]
- Ciupei, D.; Colişar, A.; Leopold, L.; Stănilă, A.; Diaconeasa, Z.M. Polyphenols: From Classification to Therapeutic Potential and Bioavailability. Foods 2024, 13, 4131. [Google Scholar] [CrossRef] [Scilit]
- Dias, M.I.; Sousa, M.J.; Alves, R.C.; Ferreira, I.C.F.R. Exploring Plant Tissue Culture to Improve the Production of Phenolic Compounds: A Review. Ind. Crops Prod. 2016, 82, 9–22. [Google Scholar] [CrossRef] [Scilit]
- Giri, L.; Singh, L.; Bhatt, I.D. In Vitro Production of Phenolic Compound. In Nutraceuticals Production from Plant Cell Factory; Springer: Singapore, 2022. [Google Scholar]
- Nikolova, M.; Gevrenova, R. Determination of Phenolic Acids in Amaryllidaceae Species by High Performance Liquid Chromatography. Pharm. Biol. 2005, 43, 289–291. [Google Scholar] [CrossRef] [Scilit]
- Hundur, D.O.; Idil, O.; Kandemir, N.; Gul, M.; Konar, V. Phytochemical Screening and In-Vitro Antioxidant, Antimicrobial Activity and DNA Interaction of Leucojum aestivum. Fresenius Environ. Bull. 2018, 27, 6704–6710. [Google Scholar]
- Dheyaa, H.; Hussein, F.; Bulduk, I.; Kahraman, A. Biochemical and Micro-Morphoanatomical Investigations on Leucojum aestivum L. Not. Bot. Horti Agrobot. Cluj-Napoca 2019, 47, 1382–1393. [Google Scholar] [CrossRef] [Scilit]
- Ates, M.; Yildirim, A.; Turker, A. Enhancement of Alkaloid Content (Galanthamine and Lycorine) and Antioxidant Activities (Enzymatic and Non-Enzymatic) Unders Salt Stress in Summer Snowflake (Leucojum aestivum L.). S. Afr. J. Bot. 2021, 140, 182–188. [Google Scholar] [CrossRef] [Scilit]
- Demir, S.; Yildirim, A.; Turker, A.; Eker, İ. Seasonal Variation in Alkaloid Content, Phenolic Constituent and Biological Activities of Some Leucojum aestivum L. Populations in Turkey. S. Afr. J. Bot. 2022, 147, 713–723. [Google Scholar] [CrossRef] [Scilit]
- Murthy, H.N.; Lee, E.-J.; Paek, K.-Y. Production of Secondary Metabolites from Cell and Organ Cultures: Strategies and Approaches for Biomass Improvement and Metabolite Accumulation. Plant Cell Tissue Organ Cult. PCTOC 2014, 118, 1–16. [Google Scholar] [CrossRef] [Scilit]
- Ivanov, I.; Georgiev, V.; Georgiev, M.; Ilieva, M.; Pavlov, A. Galanthamine and Related Alkaloids Production by Leucojum aestivum L. Shoot Culture Using a Temporary Immersion Technology. Appl. Biochem. Biotechnol. 2011, 163, 268–277. [Google Scholar] [CrossRef] [Scilit]
- Ivanov, I.; Georgiev, V.; Berkov, S.; Pavlov, A. Alkaloid Patterns in Leucojum aestivum Shoot Culture Cultivated at Temporary Immersion Conditions. J. Plant Physiol. 2012, 169, 206–211. [Google Scholar] [CrossRef] [Scilit]
- Szymańska, R.; Ślesak, I.; Orzechowska, A.; Kruk, J. Physiological and Biochemical Responses to High Light and Temperature Stress in Plants. Environ. Exp. Bot. 2017, 139, 165–177. [Google Scholar] [CrossRef] [Scilit]
- Georgiev, V.; Ivanov, I.; Berkov, S.; Ilieva, M.; Georgiev, M.; Gocheva, T.; Pavlov, A. Galanthamine Production by Leucojum aestivum L. Shoot Culture in a Modified Bubble Column Bioreactor with Internal Sections. Eng. Life Sci. 2012, 12, 534–543. [Google Scholar] [CrossRef] [Scilit]
- Ptak, A. Somatic Embryogenesis in in Vitro Culture of Leucojum vernum L. Methods Mol. Biol. 2010, 589, 223–233. [Google Scholar]
- Sellés, M.; Viladomat, F.; Bastida, J.; Codina, C. Callus Induction, Somatic Embryogenesis and Organogenesis in Narcissus confusus: Correlation between the State of Differentiation and the Content of Galanthamine and Related Alkaloids. Plant Cell Rep. 1999, 18, 646–651. [Google Scholar] [CrossRef] [Scilit]
- Malik, M.; Bach, A. High-Yielding Repetitive Somatic Embryogenesis in Cultures of Narcissus L. ‘Carlton’. Acta Sci. Pol. Hortorum Cultus 2017, 12, 107–112. [Google Scholar]
- Resetár, A.; Freytag, C.; Kalydi, F.; Gonda, S.; M-Hamvas, M.; Ajtay, K.; Papp, L.; Máthé, C. Production and Antioxidant Capacity of Tissue Cultures from Four Amaryllidaceae Species. Acta Soc. Bot. Pol. 2017, 86, 3525. [Google Scholar] [CrossRef] [Scilit]
- Parolo, G.; Abeli, T.; Rossi, G.; Dowgiallo, G.; Matthies, D. Biological Flora of Central Europe: Leucojum aestivum L. Perspect. Plant Ecol. Evol. Syst. 2011, 13, 319–330. [Google Scholar] [CrossRef] [Scilit]
- Shao, L.; Yang, L.; Li, X.; Zhou, L.; Zhu, J.; Zhang, Y. From Bulb Development to Postharvest Treatments: Advances in Hippeastrum spp. Research and Industry Applications. Ornam. Plant Res. 2025, 5, e026. [Google Scholar] [CrossRef] [Scilit]
- Chauhan, J.; Prathibha, M.; Singh, P.; Choyal, P.; Mishra, U.N.; Saha, D.; Kumar, R.; Anuragi, H.; Pandey, S.; Bose, B.; et al. Plant Photosynthesis under Abiotic Stresses: Damages, Adaptive, and Signaling Mechanisms. Plant Stress 2023, 10, 100296. [Google Scholar] [CrossRef] [Scilit]
- Vaz, A.P.A.; Figueiredo-Ribeiro, R.d.C.L.; Kerbauy, G.B. Photoperiod and Temperature Effects on in Vitro Growth and Flowering of P. pusilla, an Epiphytic Orchid. Plant Physiol. Biochem. PPB 2004, 42, 411–415. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Zhang, C.; Xu, B.; Fu, J.; Du, Y.; Fang, Q.; Dong, B.; Zhao, H. Temperature Regulation of Carotenoid Accumulation in the Petals of Sweet Osmanthus via Modulating Expression of Carotenoid Biosynthesis and Degradation Genes. BMC Genom. 2022, 23, 418. [Google Scholar] [CrossRef] [Scilit]
- Mansinhos, I.; Gonçalves, S.; Rodríguez-Solana, R.; Ordóñez-Díaz, J.L.; Moreno-Rojas, J.M.; Romano, A. Impact of Temperature on Phenolic and Osmolyte Contents in In Vitro Cultures and Micropropagated Plants of Two Mediterranean Plant Species, Lavandula viridis and Thymus lotocephalus. Plants 2022, 11, 3516. [Google Scholar] [CrossRef] [Scilit]
- Bose, B.; Kumaria, S.; Tandon, P. Physiological Insights into the Role of Temperature and Light Conditions on in Vitro Growth, Membrane Thermostability and Antioxidative Activity of Nardostachys jatamansi, an IUCN Red-Listed Critically Endangered Therapeutic Plant. S. Afr. J. Bot. 2022, 146, 365–374. [Google Scholar] [CrossRef] [Scilit]
- Bidabadi, S.S.; Jain, S.M. Cellular, Molecular, and Physiological Aspects of In Vitro Plant Regeneration. Plants 2020, 9, 702. [Google Scholar] [CrossRef] [Scilit]
- Jeandet, P.; Formela-Luboińska, M.; Labudda, M.; Morkunas, I. The Role of Sugars in Plant Responses to Stress and Their Regulatory Function during Development. Int. J. Mol. Sci. 2022, 23, 5161. [Google Scholar] [CrossRef] [Scilit]
- Ciereszko, I. Regulatory Roles of Sugars in Plant Growth and Development. Acta Soc. Bot. Pol. 2018, 87, 3583. [Google Scholar] [CrossRef] [Scilit]
- Lunn, J.E. Sucrose Metabolism. In Encyclopedia of Life Sciences; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2016; pp. 1–9. ISBN 978-0-470-01590-2. [Google Scholar]
- Zhang, W.; Song, L.; Teixeira da Silva, J.; Sun, H. Effects of Temperature, Plant Growth Regulators and Substrates and Changes in Carbohydrate Content during Bulblet Formation by Twin Scale Propagation in Hippeastrum vittatum ‘Red Lion’. Sci. Hortic. 2013, 160, 230–237. [Google Scholar] [CrossRef] [Scilit]
- Yamagishi, M. Effects of Culture Temperature on the Enlargement, Sugar Uptake, Starch Accumulation, and Respiration of in Vitro Bulblets of Lilium japonicum Thunb. Sci. Hortic. 1998, 73, 239–247. [Google Scholar] [CrossRef] [Scilit]
- Li, W.; Huang, D.; Wang, B.; Hou, X.; Zhang, R.; Yan, M.; Liao, W. Changes of Starch and Sucrose Content and Related Gene Expression during the Growth and Development of Lanzhou Lily Bulb. PLoS ONE 2022, 17, e0262506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shohael, A.M.; Ali, M.B.; Yu, K.-W.; Hahn, E.-J.; Paek, K.-Y. Effect of Temperature on Secondary Metabolites Production and Antioxidant Enzyme Activities in Eleutherococcus senticosus Somatic Embryos. Plant Cell Tissue Organ Cult. 2006, 85, 219–228. [Google Scholar] [CrossRef] [Scilit]
- Abarca, D.; Roldán, M.; Martín, M.; Sabater, B. Arabidopsis Thaliana Ecotype Cvi Shows an Increased Tolerance to Photo-Oxidative Stress and Contains a New Chloroplastic Copper/Zinc Superoxide Dismutase Isoenzyme. J. Exp. Bot. 2001, 52, 1417–1425. [Google Scholar] [CrossRef] [Scilit]
- Samis, K.; Bowley, S.; McKersie, B. Pyramiding Mn-Superoxide Dismutase Transgenes to Improve Persistence and Biomass Production in Alfalfa. J. Exp. Bot. 2002, 53, 1343–1350. [Google Scholar] [CrossRef] [Scilit]
- Caetano, A.R.; Oliveira, R.D.; Celeiro, S.P.; Freitas, A.S.; Cardoso, S.M.; Gonçalves, M.S.T.; Baltazar, F.; Almeida-Aguiar, C. Phenolic Compounds Contribution to Portuguese Propolis Anti-Melanoma Activity. Molecules 2023, 28, 3107. [Google Scholar] [CrossRef] [Scilit]
- Shabani, M.; Jamali, Z.; Bayrami, D.; Salimi, A. Vanillic Acid Alleviates Methamphetamine-Induced Mitochondrial Toxicity in Cardiac Mitochondria via Antioxidant Activity and Inhibition of MPT Pore Opening: An in-Vitro Study. BMC Pharmacol. Toxicol. 2023, 24, 33. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.; Chang, A.; Peng, H.; Huang, H.; Hu, P.; Yao, A.; Yin, X.; Qu, C.; Ni, B.; Dong, X.; et al. Isoferulic Acid Regulates CXCL12/CXCR4-Mediated Apoptosis and Autophagy in Podocyte and Mice with STZ-Induced Diabetic Nephropathy. Int. Immunopharmacol. 2025, 144, 113707. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pei, K.; Ou, J.; Huang, J.; Ou, S. P-Coumaric Acid and Its Conjugates: Dietary Sources, Pharmacokinetic Properties and Biological Activities. J. Sci. Food Agric. 2016, 96, 2952–2962. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, A.; Saranyadevi, S.; Thirumalaisamy, S.K.; Dapana Durage, T.T.; Jaiswal, S.G.; Kavitake, D.; Wei, S. Phenolic Acids in Fermented Foods: Microbial Biotransformation, Antioxidant Mechanisms, and Functional Health Implications. Front. Mol. Biosci. 2025, 12, 1678673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rani, R.; Khan, M.; Kayani, W.; Ullah, S.; Naeem, I.; Mirza, B. Metabolic Signatures Altered by in Vitro Temperature Stress in Ajuga bracteosa Wall. Ex. Benth. Acta Physiol. Plant. 2017, 39, 10. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Yuan, B.; Huang, B. Differential Heat-Induced Changes in Phenolic Acids Associated with Genotypic Variations in Heat Tolerance for Hard Fescue. Crop Sci. 2019, 59, 667–674. [Google Scholar] [CrossRef] [Scilit]
- Šamec, D.; Karalija, E.; Šola, I.; Vujčić Bok, V.; Salopek-Sondi, B. The Role of Polyphenols in Abiotic Stress Response: The Influence of Molecular Structure. Plants 2021, 10, 118. [Google Scholar] [CrossRef] [Scilit]
- Nair, J.J.; van Staden, J. Cytotoxic Crinane Alkaloids of the Amaryllidaceae: In Vitro, in Vivo and in Silico Effects, Structure–Activity Relationships and Mechanisms of Action. Phytochem. Rev. 2025, 1–66. [Google Scholar] [CrossRef] [Scilit]
- Guo, J.; Yang, B.; Jing, C.; Chen, D.; Hao, X. Rapid Synthesis of Ismine, a Bioactive Amaryllidaceae Alkaloid. J. Chem. Res. 2017, 41, 202–204. [Google Scholar] [CrossRef] [Scilit]
- Georgieva, L.; Berkov, S.; Kondakova, V.; Bastida, J.; Viladomat, F.; Atanassov, A.; Codina, C. Alkaloid Variability in Leucojum aestivum from Wild Populations. Z. Für Naturforschung C 2007, 62, 627–635. [Google Scholar] [CrossRef] [Scilit]
- Ptak, A.; El Tahchy, A.; Skrzypek, E.; Wójtowicz, T.; Laurain-Mattar, D. Influence of Auxins on Somatic Embryogenesis and Alkaloid Accumulation in Leucojum aestivum Callus. Cent. Eur. J. Biol. 2013, 8, 591–599. [Google Scholar] [CrossRef] [Scilit]
- Narayani, M.; Srivastava, S. Elicitation: A Stimulation of Stress in in Vitro Plant Cell/Tissue Cultures for Enhancement of Secondary Metabolite Production. Phytochem. Rev. 2017, 16, 1227–1252. [Google Scholar] [CrossRef] [Scilit]
- Aguirre-Becerra, H.; de la O, D.S.; Ferruzquía-Jiménez, N.; Parra-Pacheco, B.; Acosta Lizárraga, L.G.; Hernandez, M.C.; Rosales, A.; Escalante, K.; García-Trejo, J.; Feregrino-Perez, A. Role of Stress in Plant Secondary Metabolites Production. In Plant Specialized Metabolites: Phytochemistry, Ecology and Biotechnology; Springer Nature Switzerland: Cham, Switzerland, 2023; pp. 1–44. ISBN 978-3-031-30037-0. [Google Scholar]
- Tisserat, B.; Berhow, M. Production of Pharmaceuticals from Papaver Cultivars in Vitro. Eng. Life Sci. 2009, 9, 190–196. [Google Scholar] [CrossRef] [Scilit]
- Toivonen, L.; Laakso, S.; Rosenqvist, H. The Effect of Temperature on Growth, Indole Alkaloid Accumulation and Lipid Composition of Catharanthus roseus Cell Suspension Cultures. Plant Cell Rep. 1992, 11, 390–394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reshi, Z.A.; Ahmad, W.; Lukatkin, A.S.; Javed, S.B. From Nature to Lab: A Review of Secondary Metabolite Biosynthetic Pathways, Environmental Influences, and In Vitro Approaches. Metabolites 2023, 13, 895. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehmann, T.; Pollmann, S. Gene Expression and Characterization of a Stress-Induced Tyrosine Decarboxylase from Arabidopsis thaliana. FEBS Lett. 2009, 583, 1895–1900. [Google Scholar] [CrossRef] [Scilit]
- Kabera, J. Plant Secondary Metabolites: Biosynthesis, Classification, Function and Pharmacological Classification, Function and Pharmacological Properties. J. Pharm. Pharmacol. 2014, 2, 377–392. [Google Scholar]
- Singh, A.; Desgagné-Penix, I. Transcriptome and Metabolome Profiling of Narcissus pseudonarcissus ‘King Alfred’ Reveal Components of Amaryllidaceae Alkaloid Metabolism. Sci. Rep. 2017, 7, 17356. [Google Scholar] [CrossRef] [Scilit]
- Tousignant, L.; Diaz-Garza, A.M.; Majhi, B.B.; Gélinas, S.-E.; Singh, A.; Desgagne-Penix, I. Transcriptome Analysis of Leucojum aestivum and Identification of Genes Involved in Norbelladine Biosynthesis. Planta 2022, 255, 30. [Google Scholar] [CrossRef] [Scilit]
- Desgagné-Penix, I. Biosynthesis of Alkaloids in Amaryllidaceae Plants: A Review. Phytochem. Rev. 2021, 20, 409–431. [Google Scholar] [CrossRef] [Scilit]
- Kilgore, M.B.; Augustin, M.M.; May, G.D.; Crow, J.A.; Kutchan, T.M. CYP96T1 of Narcissus Sp. Aff. Pseudonarcissus Catalyzes Formation of the Para-Para’ C-C Phenol Couple in the Amaryllidaceae Alkaloids. Front. Plant Sci. 2016, 7, 225. [Google Scholar] [CrossRef] [Scilit]
- Lamichhane, B.; Gélinas, S.-E.; Merindol, N.; Koirala, M.; dos Santos, K.C.G.; Germain, H.; Desgagné-Penix, I. Elucidating the Enzyme Network Driving Amaryllidaceae Alkaloids Biosynthesis in Leucojum aestivum. Plant Biotechnol. J. 2025, 23, 1988–2005. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kilgore, M.B.; Augustin, M.M.; Starks, C.M.; O’Neil-Johnson, M.; May, G.D.; Crow, J.A.; Kutchan, T.M. Cloning and Characterization of a Norbelladine 4′-o-Methyltransferase Involved in the Biosynthesis of the Alzheimer’s Drug Galanthamine in Narcissus Sp. Aff. Pseudonarcissus. PLoS ONE 2014, 9, e103223. [Google Scholar] [CrossRef] [Scilit]
- Murashige, T.; Skoog, F. A Revised Medium for Rapid Growth and Bio Assays with Tobacco Tissue Cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef] [Scilit]
- Lichtenthaler, H.K.; Wellburn, A.R. Determinations of Total Carotenoids and Chlorophylls a and b of Leaf Extracts in Different Solvents. Biochem. Soc. Trans. 1983, 11, 591–592. [Google Scholar] [CrossRef] [Scilit]
- Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric Method for Determination of Sugars and Related Substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef] [Scilit]
- McCord, J.M.; Fridovich, I. Superoxide Dismutase an Enzymic Function for Erythrocuprein (Hemocuprein). J. Biol. Chem. 1969, 244, 6049–6055. [Google Scholar] [CrossRef] [Scilit]
- Aebi, H. Catalase in Vitro. In Methods in Enzymology; Oxygen Radicals in Biological Systems; Academic Press: Cambridge, MA, USA, 1984; Volume 105, pp. 121–126. [Google Scholar]
- Lück, H. Peroxidase. In Methoden der Enzymatischen Analyse; Bergmeyer, H.U., Ed.; Verlag Chemie: Weinheim, Germany, 1962; pp. 895–897. [Google Scholar]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Saliba, S.; Ptak, A.; Boisbrun, M.; Spina, R.; Dupire, F.; Laurain-Mattar, D. Stimulating Effect of Both 4′-O-Methylnorbelladine Feeding and Temporary Immersion Conditions on Galanthamine and Lycorine Production by Leucojum aestivum L. Bulblets. Eng. Life Sci. 2016, 16, 731–739. [Google Scholar] [CrossRef] [Scilit]
- Spina, R.; Saliba, S.; Dupire, F.; Ptak, A.; Hehn, A.; Piutti, S.; Poinsignon, S.; Leclerc, S.; Bouguet-Bonnet, S.; Laurain-Mattar, D. Molecular Identification of Endophytic Bacteria in Leucojum aestivum In Vitro Culture, NMR-Based Metabolomics Study and LC-MS Analysis Leading to Potential Amaryllidaceae Alkaloid Production. Int. J. Mol. Sci. 2021, 22, 1773. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Pulman, J. A Transcriptomics Approach to Understanding Polymorphic and Transcript Level Differences Linked to Isoquinoline Alkaloid Production in Triploid Varieties of Narcissus pseudonarcissus. Ph.D. Thesis, University of Liverpool, Liverpool, UK, 2015. [Google Scholar]







| Temperature [°C] | Number of Leaves per Plant | Number of Roots per Plant | FW Increments of Plants [mg] | DW Accumulation in Plants [%] |
|---|---|---|---|---|
| 15 | 1.24 ± 0.09 c | 1.40 ± 0.20 a | 60 ± 0.03 c | 24.94 ± 3.10 b |
| 20 | 2.32 ± 0.11 b | 0.52 ± 0.10 b | 160 ± 0.04 b | 25.98 ± 2.16 b |
| 25 | 2.68 ± 0.10 a | 1.28 ± 0.12 a | 430 ± 0.03 a | 43.19 ± 0.02 a |
| 30 | 1.24 ± 0.09 c | 0 ± 0.00 c | 170 ± 0.49 b | 25.22 ± 0.03 b |
| Temperature [°C] | Chlorophyll a [µg/g FW] | Chlorophyll b [µg/g FW] | Carotenoids [µg/g FW] |
|---|---|---|---|
| 15 | 38.76 ± 4.60 a | 26.35 ± 2.46 a | 13.06 ± 2.22 a |
| 20 | 44.33 ± 4.88 a | 27.29 ± 2.82 a | 12.55 ± 1.80 a |
| 25 | 38.10 ± 4.53 a | 26.88 ± 2.73 a | 9.86 ± 1.24 a |
| 30 | 31.19 ± 2.80 a | 21.08 ± 1.97 a | 8.46 ± 1.73 a |
| Phenolic Acids [µg/g DW] | Temperature [°C] | |||
|---|---|---|---|---|
| 15 | 20 | 25 | 30 | |
| chlorogenic | 0.19 ± 0.003 a | 0.16 ± 0.013 b | 0.13 ± 0.001 c | 0.10 ± 0.005 d |
| caffeic | 1.40 ± 0.147 a | 0.95 ± 0.086 b | 1.05 ± 0.004 b | 1.36 ± 0.065 a |
| vanillic | 2.26 ± 0.018 b | 1.24 ± 0.039 c | 2.53 ± 0.120 a | 2.54 ± 0.030 a |
| p-coumaric | 3.44 ± 0.094 a | 2.83 ± 0.214 b | 2.68 ± 0.131 b | 3.20 ± 0.192 ab |
| sinapic | 0.75 ± 0.013 a | 0.58 ± 0.069 b | 0.50 ± 0.041 b | 0.45 ± 0.033 b |
| ferulic | 4.69 ± 0.257 a | 2.68 ± 0.160 c | 2.62 ± 0.196 c | 3.39 ± 0.210 b |
| isoferulic | 0.58 ± 0.115 a | 0.48 ± 0.072 a | 0.38 ± 0.068 a | 0.47 ± 0.068 a |
| No | Alkaloid | Formula | Retention Time [min] | Base Peak | Temperature [°C] | |||
|---|---|---|---|---|---|---|---|---|
| 15 | 20 | 25 | 30 | |||||
| 1 | Ismine | C15H15NO3 | 13.37 | 238 | 0.4 | - | - | - |
| 2 | Galanthamine | C17H21NO3 | 15.02 | 286 | - | 16.2 | 9.1 | 10.2 |
| 3 | Crinan-3-ol (vittatine) | C16H19NO3 | 15.57 | 272 | - | 10.1 | 0.9 | 0.7 |
| 4 | Demethylmaritidine | C16H19NO3 | 16.48 | 201 | 9.9 | 7.5 | 3.6 | 7 |
| 5 | Crinine | C16H17NO3 | 16.85 | 239 | 23.6 | 11.7 | 9.8 | 25.6 |
| 6 | Tazettine | C18H21NO5 | 18.50 | 246 | 3 | - | - | - |
| 7 | 11-Hydroxyvittatine | C16H17NO4 | 19.27 | 258 | - | 13.1 | 13 | 10.1 |
| 8 | Lycorine | C16H17NO4 | 19.80 | 226 | 55.4 | 37.9 | 50.2 | 44.7 |
| 9 | Epiisohaemanthamine | C17H19NO4 | 20.51 | 301 | - | - | 2.2 | 2.9 |
| 10 | Chlidanthine | C17H21NO3 | 20.77 | 228 | - | 2.8 | - | 1 |
| Temperature [°C] | Galanthamine [µg/g DW] | Lycorine [µg/g DW] |
|---|---|---|
| 15 | 5.81 ± 0.001 b | 269.50 ± 0.013 a |
| 20 | 107.38 ± 0.02 a | 178.53 ± 0.006 b |
| 25 | 35.27 ± 0.016 b | 209.43 ± 0.016 b |
| 30 | 104.09 ± 0.012 a | 268.75 ± 0.002 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Ptak, A.; Warchoł, M.; Morańska, E.; Laurain-Mattar, D.; Spina, R.; Dupire, F.; Waligórski, P.; Simlat, M. Amaryllidaceae Alkaloids and Phenolic Acids Identification in Leucojum aestivum L. Plant Cultures Exposed to Different Temperature Conditions. Molecules 2026, 31, 258. https://doi.org/10.3390/molecules31020258
Ptak A, Warchoł M, Morańska E, Laurain-Mattar D, Spina R, Dupire F, Waligórski P, Simlat M. Amaryllidaceae Alkaloids and Phenolic Acids Identification in Leucojum aestivum L. Plant Cultures Exposed to Different Temperature Conditions. Molecules. 2026; 31(2):258. https://doi.org/10.3390/molecules31020258
Chicago/Turabian StylePtak, Agata, Marzena Warchoł, Emilia Morańska, Dominique Laurain-Mattar, Rosella Spina, François Dupire, Piotr Waligórski, and Magdalena Simlat. 2026. "Amaryllidaceae Alkaloids and Phenolic Acids Identification in Leucojum aestivum L. Plant Cultures Exposed to Different Temperature Conditions" Molecules 31, no. 2: 258. https://doi.org/10.3390/molecules31020258
APA StylePtak, A., Warchoł, M., Morańska, E., Laurain-Mattar, D., Spina, R., Dupire, F., Waligórski, P., & Simlat, M. (2026). Amaryllidaceae Alkaloids and Phenolic Acids Identification in Leucojum aestivum L. Plant Cultures Exposed to Different Temperature Conditions. Molecules, 31(2), 258. https://doi.org/10.3390/molecules31020258

