Effect of Paulownia Leaves Extract Levels on In Vitro Ruminal Fermentation, Microbial Population, Methane Production, and Fatty Acid Biohydrogenation
Abstract
:1. Introduction
2. Results
2.1. Concentration of Active Compounds in the Extract
2.2. Rumen Fermentation, Gas Production, and Microbial Populations
2.3. Bacteria Quantification
2.4. Fatty Acids Profile
3. Discussion
4. Materials and Methods
4.1. Plant Material and Preparation of the Extract
4.2. Phytochemical Analysis of Paulownia Leaves Extract
4.3. Experimental Design and Treatments
4.4. In Vitro Batch Culture
4.5. Sampling and Analysis
4.5.1. Ruminal Fermentation, Methane Production, Microbial Population, and Fatty Acids Profile
4.5.2. Bacterial Quantification
5. Statistical Analysis
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Tsoraeva, E.; Bekmurzov, A.; Kozyrev, S.; Khoziev, A.; Kozyrev, A. Environmental issues of agriculture as a consequence of the intensification of the development of agricultural industry. E3S Web Conf. 2020, 215, 02003. [Google Scholar] [CrossRef]
- Clay, N.; Garnett, T.; Lorimer, J. Dairy intensification: Drivers, impacts and alternatives. Ambio 2020, 49, 35–48. [Google Scholar] [CrossRef] [Green Version]
- Puchalska, J.; Szumacher-Strabel, M.; Patra, A.K.; Ślusarczyk, S.; Gao, M.; Petrič, D.; Nabzdyk, M.; Cieślak, A. The Effect of Different Concentrations of Total Polyphenols from Paulownia Hybrid Leaves on Ruminal Fermentation, Methane Production and Microorganisms. Animals 2021, 11, 2843. [Google Scholar] [CrossRef] [PubMed]
- Reisigner, A.; Clark, H. How much do direct livestock emissions actually contribute to global warming? Glob. Chang. Biol. 2018, 24, 1749–1761. [Google Scholar]
- Watts, N.; Amann, M.; Arnell, N.; Ayeb-Karlsson, S.; Beagley, J.; Belesova, K.; Boykoff, M.; Byass, P.; Cai, W.; Campbell-Lendrum, D.; et al. The 2020 report of The Lancet Countdown on health and climate change: Responding to converging crises. Lancet 2021, 397, 129–170. [Google Scholar] [CrossRef]
- Saunois, M.; Bousquet, P.; Poulter, B.; Peregon, A.; Ciais, P.; Canadell, J.G.; Dlugokencky, E.J.; Etiope, G.; Bastviken, D.; Houweling, S.; et al. The Global Methane Budget: 2000–2012. Earth Syst. Sci. Data 2016, 8, 697–751. [Google Scholar] [CrossRef] [Green Version]
- Franzluebbers, A.J. Cattle grazing effects on the environment: Greenhouse gas emissions and carbon footprint. In Management Strategies for Sustainable Cattle Production in Southern Pastures; Roquette, M., Aiken, G.E., Eds.; Academic Press: Cambridge, MA, USA, 2020; pp. 11–34. [Google Scholar]
- Singh, P.; Hundal, J.S.; Patra, A.K.; Wadhwa, M.; Sharma, A. Sustainable utilization of Aloe vera waste in the diet of lactating cows for improvement of milk production performance and reduction of carbon footprint. J. Clean. Prod. 2021, 288, 125118. [Google Scholar] [CrossRef]
- Huang, H.; Szumacher-Strabel, M.; Patra, A.K.; Ślusarczyk, S.; Lechniak, D.; Vazirigohar, M.; Varadyova, Z.; Kozłowska, M.; Cieślak, A. Chemical and phytochemical composition, in vitro ruminal fermentation, methane production, and nutrient degradability of fresh and ensiled Paulownia hybrid leaves. Anim. Feed Sci Technol. 2021, 279, 115038. [Google Scholar] [CrossRef]
- Stochmal, A.; Moniuszko-Szajwaj, B.; Zuchowski, J.; Pecio, Ł.; Kontek, B.; Szumacher-Strabel, M.; Olas, B.; Cieślak, A. Qualitative and Quantitative Analysis of Secondary Metabolites in Morphological Parts of Paulownia Clon In Vitro 112® and Their Anticoagulant Properties in Whole Human Blood. Molecules 2022, 27, 980. [Google Scholar] [CrossRef]
- Özelçam, H.; İpçak, H.H.; Özüretmen, S.; Canbolat, Ö. Feed value of dried and ensiled paulownia (Paulownia spp.) leaves and their relationship to rumen fermentation, in vitro digestibility, and gas production characteristics. Rev. Bras. Zootec. 2021, 50, e20210057. [Google Scholar] [CrossRef]
- Pan, J.; Yuan, C.; Lin, C.; Jia, Z.; Zheng, R. Pharmacological activities and mechanisms of natural phenylpropanoid glycosides. Die Pharm. 2003, 58, 767–776. [Google Scholar] [CrossRef] [PubMed]
- Dembitsky, W.M. Astonishing diversity of natural surfactants: 5. Biologically active glycosides of aromatic metabolites. J. Lipids 2005, 40, 1081–1105. [Google Scholar] [CrossRef]
- Navarrete, S.; Kemp, P.D.; Pain, S.J.; Back, P.J. Bioactive compounds, aucubin and acteoside, in plantain (Plantago lanceolata L.) and their effect on in vitro rumen fermentation. Anim. Feed Sci. Technol. 2016, 222, 158–167. [Google Scholar] [CrossRef]
- Chiou, W.F.; Lin, L.C.; Chen, C.F. The antioxidant and free radical scavenging properties of acteoside. Chin. Pharm. J. 2003, 55, 347–353. [Google Scholar]
- Backhouse, N.; Delporte, C.; Apablaza, C. Antinociceptive activity of Buddlejaglobosa (matico) in several models of pain. J. Ethnopharmacol. 2008, 119, 160–165. [Google Scholar] [CrossRef] [PubMed]
- Adach, W.; Żuchowski, J.; Moniuszko-Szajwaj, B.; Szumacher-Strabel, M.; Stochmal, A.; Olas, B.; Cieslak, A. Comparative Phytochemical, Antioxidant, and Hemostatic Studies of Extract and Four Fractions from Paulownia Clone In Vitro 112 Leaves in Human Plasma. Molecules 2020, 25, 4371. [Google Scholar] [CrossRef]
- Nigro, O.; Tuzi, A.; Tartaro, T.; Giaquinto, A.; Vallini, I.; Pinotti, G. Biological effects of verbascoside and its anti-inflammatory activity on oral mucositis: A review of the literature. Anti-Cancer Drugs 2020, 31, 1–5. [Google Scholar] [CrossRef]
- Box, L.A.; Edwards, G.R.; Bryant, R.H. Milk production and urinary nitrogen excretion of dairy cows grazing plantain in early and late lactation. N. Z. J. Agric. Res. 2017, 60, 470–482. [Google Scholar] [CrossRef]
- Redoy, M.R.; Shuvo, A.; Cheng, L.; Al-Mamun, M. Effect of herbal supplementation on growth, immunity, rumen histology, serum antioxidants and meat quality of sheep. Animal 2020, 14, 2433–2441. [Google Scholar] [CrossRef]
- Getachew, G.; Crovetto, G.M.; Fondevila, M.; Krishnamoorthy, U.; Singh, B.; Spanghero, M.; Steingass, H.; Robinson, P.H.; Kailas, M.M. Laboratory variation of 24 h in vitro gas production and estimated metabolizable energy values of ruminant feeds. Anim. Feed Sci. Technol. 2002, 102, 169–180. [Google Scholar] [CrossRef]
- Cieślak, A.; Zmora, P.; Stochmal, A.; Pecio, L.; Oleszek, W.; Pers-Kamczyc, E.; Szczechowiak, J.; Nowak, A.; Szumacher-Strabel, M. Rumen antimethanogenic effect of Saponaria officinalis L. phytochemicals in vitro. J. Agric. Sci. 2014, 152, 981–993. [Google Scholar] [CrossRef] [Green Version]
- McAllister, T.A.; Bae, H.D.; Jones, G.A.; Cheng, K.J. Microbial attachment and feed digestion in the rumen. J. Anim. Sci. 1994, 72, 3004–3018. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jones, G.A.; McAllister, T.A.; Muir, A.D.; Cheng, K.J. Effects of Sainfoin (Onobrychisviciifolia Scop.) Condensed Tannins on Growth and Proteolysis by Four Strains of Ruminal Bacteria. Appl. Environ. Microbiol. 1994, 60, 1374–1378. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arhab, R.; Aggoun, M.; Dris, D.; Djabri, B.; Bousseboua, H. In vitro antimethanogenicruminale activity of the methanol, acetone and ethanolic extracts of Thymalaea hirsute. Acta Hortic. 2013, 997, 285–293. [Google Scholar] [CrossRef]
- Klevenhusen, F.; Muro-Reyes, A.; Khiaosa-Ard, R.; Metzler-Zebeli, B.U.; Zebeli, Q. A meta-analysis of effects of chemical composition of incubated diet and bioactive compounds on in vitro ruminal fermentation. Anim. Feed Sci. Technol. 2012, 176, 61–69. [Google Scholar] [CrossRef]
- Lee, M.R.F.; Scott, M.B.; Tweed, J.K.S.; Minchin, F.R.; Davies, D.R. Effects of polyphenol oxidase on lipolysis and proteolysis of red clover silage with and without a silage inoculant (Lactobacillus plantarum L54). Anim. Feed Sci. Technol. 2008, 144, 125–136. [Google Scholar] [CrossRef]
- Zhang, T.; Mu, Y.; Zhang, R.; Xue, Y.; Guo, C.; Qi, W.; Zhang, J.; Mao, S. Responsive changes of rumen microbiome and metabolome in dairy cows with different susceptibility to subacute ruminal acidosis. Anim. Nutr. 2022, 8, 331–340. [Google Scholar] [CrossRef]
- Cardozo, P.W.; Calsamiglia, S.; Ferret, A.; Kamel, C. Screening for the effects of natural plant extracts at different pH on in vitro rumen microbial fermentation of a high-concentrate diet for beef cattle. J. Anim. Sci. 2005, 83, 2572–2579. [Google Scholar] [CrossRef]
- Russell, J.B.; Muck, R.E.; Weimer, P.J. Quantitative analysis of cellulose degradation and growth of cellulolytic bacteria in the rumen. FEMS Microbiol. Ecol. 2009, 67, 183–197. [Google Scholar] [CrossRef]
- Soltan, Y.A.; Patra, A.K. Ruminal Microbiome Manipulation to Improve Fermentation Efficiency in Ruminants. In Animal Feed Science and Nutrition—Production, Health and Environment; Patra, A., Ed.; IntechOpen: London, UK, 2021. [Google Scholar]
- Calsamiglia, S.; Cardozo, P.W.; Ferret, A.; Bach, A. Changes in rumen microbial fermentation are due to a combined effect of type of diet and pH. Sci. J. Anim. Sci. 2008, 86, 702–711. [Google Scholar] [CrossRef]
- Henning, P.H.; Horn, C.H.; Steyn, D.G.; Meissner, H.H.; Hagg, F.M. The potential of Megasphaeraelsdenii isolates to control ruminal acidosis. Anim. Feed Sci. Technol. 2010, 157, 13–19. [Google Scholar] [CrossRef]
- Chen, L.; Liu, S.; Wang, H.; Wang, M.; Li, Y. Relative significances of pH and substrate starch level to roles of Streptococcus bovisS1 in rumen acidosis. AMB Express 2016, 6, 80. [Google Scholar] [CrossRef] [Green Version]
- Patra, A.K.; Yu, Z. Effects of vanillin, quillaja saponin, and essential oils on in vitro fermentation and protein-degrading microorganisms of the rumen. Appl. Microbiol. Biotechnol. 2014, 98, 897–905. [Google Scholar] [CrossRef] [PubMed]
- Hobson, P.N.; Stewart, C.S. The rumen bacteria. In The Rumen Microbial Ecosystem; Hobson, P.N., Stewart, C.S., Eds.; Springer: Dordrecht, The Netherlands, 1997; pp. 10–72. [Google Scholar]
- Bodas, R.; Prieto, N.; García-González, R.; Andrés, S.; Giráldez, F.J.; López, S. Manipulation of rumen fermentation and methane production with plant secondary metabolites. Anim. Feed Sci. Technol. 2012, 176, 78–93. [Google Scholar] [CrossRef]
- Newbold, C.J.; De La Fuente, G.; Belanche, A.; Ramos-Morales, E.; McEwan, N.R. The role of ciliate protozoa in the rumen. Front. Micorobiol. 2015, 6, 1313. [Google Scholar] [CrossRef] [Green Version]
- Patra, A.K.; Saxena, J. A new perspective on the use of plant secondary metabolites to inhibit methanogenesis in the rumen. Phytochemistry 2010, 71, 1198–1222. [Google Scholar] [CrossRef]
- Norrapoke, T.; Wanapat, M.; Foiklang, S. Influence of tropical plant sources containing plant secondary compound on rumen fermentation using in vitro gas fermentation technique. Indian J. Anim. Sci. 2014, 84, 1004–1010. [Google Scholar]
- Zhang, Y.; Liu, K.; Hao, X.; Xin, H. The relationships between odd-and branched-chain fatty acids to ruinal fermentation parameters and bacterial populations with different dietary ratios of forage and concentrate. J. Anim. Physiol. Anim. Nutr. 2017, 101, 1103–1114. [Google Scholar] [CrossRef]
- Zhang, Z.; Niu, X.; Fadi, L.; Guo, L. Ruminal cellulolytic bacteria abundance leads to the variation in fatty acids in the rumen digesta and meat of fattening lambs. J. Anim. Sci. 2020, 98, skaa228. [Google Scholar] [CrossRef]
- McKain, N.; Shingfield, K.J.; Wallace, R.J. Metabolism of conjugated linoleic acids and 18:1 fatty acids by ruminal bacteria: Products and mechanisms. Microbiology 2010, 156, 579–588. [Google Scholar] [CrossRef] [Green Version]
- Mannelli, F.; Cappucci, A.; Pini, F.; Pastorelli, R.; Decorosi, F.; Giovannetti, L.; Mele, M.; Minieri, S.; Conte, G.; Pauselli, M.; et al. Effect of different types of olive oil pomace dietary supplementation on the rumen microbialcommunity profile in Comisana ewes. Sci. Rep. 2018, 8, 8455. [Google Scholar] [CrossRef] [PubMed]
- Cieslak, A.; Zmora, P.; Matkowski, A.; Nawrot-Hadzik, I.; Pers-Kamczyc, E.; El-Sherbiny, M.; Bryszak, M.; Szumacher-Strabel, M. Tannins from Sanguisorba officinalis affect in vitro rumen methane production and fermentation. J. Anim. Plant Sci. 2016, 26, 54–62. [Google Scholar]
- Bryszak, M.; SzumacherStrabel, M.; Huang, H.; Pawlak, P.; Lechniak, D.; Kołodziejski, P.; Yanza, Y.R.; Patra, A.K.; Váradyová, Z.; Cieslak, A. Lupinus angustifolius seed meal supplemented to dairy cow diet improves fatty acid composition in milk and mitigates methane production. Anim. Feed Sci. Technol. 2020, 267, 114590. [Google Scholar] [CrossRef]
- Yanza, Y.R.; Szumacher-Strabel, M.; Bryszak, M.; Gao, M.; Kolodziejski, P.; Stochmal, A.; Slusarczyk, S.; Patra, A.K.; Cieslak, A. Coleus amboinicus (Lour.) leaves as a modulator of ruminal methanogenesis and biohydrogenation in vitro. J. Anim. Sci. 2018, 96, 4868–4881. [Google Scholar] [CrossRef] [PubMed]
- Poeker, S.A.; Geirnaert, A.; Berchtold, L.; Greppi, A.; Krych, L.; Steinert, R.E.; de Wouters, T.; Lacroix, C. Understanding the prebiotic potential of different dietary fibers using an in vitro continuous adult fermentation model (PolyFermS). Sci. Rep. 2018, 8, 4318–4330. [Google Scholar] [CrossRef]
- Denman, S.E.; McSweeney, C.S. Development of a real-time PCR assay for monitoring anaerobic fungal and cellulolytic bacterial populations within the rumen. FEMS Microbiol. Ecol. 2006, 58, 572–582. [Google Scholar] [CrossRef]
- Yu, Y.; Lee, C.; Kim, J.; Hwang, S. Group-specific primer and probe sets to detect methanogenic communities using quantitative real-time polymerase chain reaction. Biotechnol. Bioeng. 2005, 89, 670–679. [Google Scholar] [CrossRef]
- Potu, R.B.; AbuGhazaleh, A.A.; Hastings, D.; Jones, K.; Ibrahim, S.A. The effect of lipid supplements on ruminal bacteria in continuous culture fermenters varies with the fatty acid composition. J. Microbiol. 2011, 49, 216–223. [Google Scholar] [CrossRef]
- Wang, R.F.; Cao, W.W.; Cerniglia, C.E. PCR detection of Ruminococcus spp. in human and animal faecal samples. Mol. Cell. Probes 1997, 11, 259–265. [Google Scholar] [CrossRef]
- Li, M.; Penner, G.B.; Hernandez-Sanabria, E.; Oba, M.; Guan, L.L. Effects of sampling location and time, and host animal on assessment of bacterial diversity and fermentation parameters in the bovine rumen. J. Appl. Microbiol. 2009, 107, 1924–1934. [Google Scholar] [CrossRef]
- Minuti, A.; Palladino, A.; Khan, M.J.; Alqarni, S.; Agrawal, A.; Piccioli-Capelli, F.; Hidalgo, F.; Cardoso, F.C.; Trevisi, E.; Loor, J.J. Abundance of ruminal bacteria, epithelial gene expression, and systemic biomarkers of metabolism and inflammation are altered during the peripartal period in dairy cows. J. Dairy Sci. 2015, 98, 8940–8951. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Compounds | Concentration (mg/g DM) |
---|---|
Phenolic compounds | |
Caffeic acid-Hex-dHex | 2.7 ± 0.09 * |
Luteolin-HexA-HexA | 6.5 ± 0.14 # |
Hydroxyverbascoside I | 5.5 ± 0.12 * |
Hydroxyverbascoside II | 6.4 ± 0.09 * |
Apigenin-HexA-HexA | 11.3 ± 0.26 # |
Methoxyverbascoside | 10.1 ± 0.19 * |
Verbascoside | 2.6 ± 0.08 |
Dimethylverbascoside | 3.7 ± 0.17 * |
Other | 35.6 ± 2.11 * |
Total | 84.4 ± 2.50 |
Iridoids | |
Catalpol | traces |
7-Hydroxytomentoside/aucubin | 14.9 ± 0.80 ‡ |
Total | 14.9 ± 0.80 ‡ |
Triterpenoids | |
Total C30H48O6-Hex † | 0.45 ± 0.027 † |
Total C30H48O6 † | 0.25 ± 0.016 † |
Total C30H48O5 † | 0.92 ± 0.058 † |
Maslinic acid | 0.34 ± 0.024 |
Total C30H48O4 † | 0.43 ± 0.030 † |
Total C30H48O3 † | 0.19 ± 0.016 † |
Total | 2.59 ± 0.133 |
Parameters | CON | PLE mg/kg (DM) | SEM | p-ANOVA | Contrast | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
100 | 200 | 400 | 600 | 800 | 1000 | L | Q | C | Log | ||||
Rumen fermentation | |||||||||||||
pH | 6.33 | 6.24 | 6.23 | 6.20 | 6.23 | 6.21 | 6.22 | 0.011 | 0.123 | 0.05 | 0.16 | 0.24 | 0.008 |
NH3, mM | 19.6 | 18.6 | 18.2 | 18.5 | 16.3 | 16.5 | 16.3 | 0.198 | 0.021 | <0.001 | <0.001 | <0.001 | 0.003 |
Total VFA, mM | 47.3 | 46.4 | 46.7 | 45.8 | 46.1 | 46.4 | 45.1 | 0.158 | 0.041 | <0.001 | <0.001 | <0.001 | <0.001 |
Individual VFA, mol/100 mol | VFA, mol/ 100 mol | ||||||||||||
Acetate (A) | 60.7 | 55.3 | 53.9 | 53.7 | 51.7 | 49.8 | 50.4 | 0.470 | 0.002 | <0.001 | <0.001 | <0.001 | 0.018 |
Propionate (P) | 22.4 | 25.8 | 26.5 | 27.5 | 27.7 | 27.8 | 29.1 | 0.281 | 0.273 | <0.001 | <0.001 | <0.001 | <0.001 |
Isobutyrate | 1.36 | 1.28 | 1.51 | 1.66 | 1.57 | 1.93 | 1.87 | 0.046 | 0.011 | <0.001 | <0.001 | <0.001 | 0.046 |
Butyrate | 13 | 15.4 | 15.4 | 14.2 | 16.0 | 17.0 | 15.2 | 0.284 | 0.578 | 0.12 | 0.26 | 0.42 | <0.001 |
Isovalerate | 1.31 | 0.99 | 1.45 | 1.74 | 1.88 | 2.20 | 2.36 | 0.068 | <0.001 | <0.001 | <0.001 | <0.001 | 0.013 |
Valerate | 1.23 | 1.23 | 1.24 | 1.2 | 1.15 | 1.27 | 1.07 | 0.035 | 0.731 | 0.18 | 0.16 | 0.15 | <0.001 |
A/P ratio | 2.71 | 2.14 | 2.03 | 1.95 | 1.87 | 1.79 | 1.73 | 0.038 | 0.029 | <0.001 | <0.001 | <0.001 | <0.001 |
IVDMD, % | 66.8 | 64.9 | 62.0 | 60.0 | 58.6 | 56.8 | 55.3 | 0.501 | 0.003 | <0.001 | <0.001 | <0.001 | <0.001 |
Total gas and methane production | |||||||||||||
Total gas, mL/g DM | 280 | 265 | 264 | 257 | 252 | 235 | 208 | 6.57 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
CH4, mmol/g DM | 2.47 | 2.21 | 2.13 | 2.04 | 1.85 | 1.73 | 1.44 | 0.093 | <0.001 | <0.001 | <0.001 | <0.001 | 0.284 |
CH4, mmol/L total gas | 8.34 | 8.35 | 8.06 | 7.93 | 7.85 | 7.51 | 6.62 | 0.198 | 0.009 | <0.001 | <0.001 | <0.001 | 0.096 |
CH4 mmol/g IVDDM | 3.70 | 3.41 | 3.44 | 3.40 | 3.16 | 3.05 | 2.60 | 0.007 | 0.014 | <0.001 | <0.001 | <0.001 | <0.001 |
Microbial population | |||||||||||||
Ophyosclecidae, 104/mL | 1.65 | 1.30 | 1.20 | 1.13 | 1.05 | 0.93 | 0.82 | 0.034 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
Isotrichidae, 103/mL | 2.96 | 2.77 | 2.07 | 1.83 | 2.30 | 2.30 | 2.07 | 0.111 | 0.249 | 0.09 | 0.23 | 0.3 | 0.340 |
Total protozoa, 104/mL | 1.94 | 1.58 | 1.41 | 1.33 | 1.28 | 1.16 | 1.03 | 0.039 | 0.027 | <0.001 | <0.001 | <0.001 | <0.001 |
Total bacteria, 108/mL | 22.4 | 17.2 | 17.9 | 17.6 | 16.7 | 15.7 | 14.5 | 0.406 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
Total methanogens, 107/mL | 5.17 | 2.86 | 2.51 | 2.87 | 2.06 | 1.49 | 1.27 | 0.151 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
Items * | CON | PLE (mg/kg DM) | SEM | p-ANOVA | Contrast | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
100 | 200 | 400 | 600 | 800 | 1000 | L | Q | C | Log | ||||
Fibrobacter succinogenes | 3.99 | 2.40 | 1.90 | 2.03 | 1.73 | 1.38 | 1.25 | 0.184 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
Anaerovibrio lipolytica | 0.97 | 1.62 | 1.89 | 2.76 | 3.24 | 4.87 | 6.56 | 0.395 | <0.001 | <0.001 | <0.001 | <0.001 | 0.829 |
Butyrivibrio fibrisolvens | 1.17 | 1.38 | 1.62 | 1.98 | 1.24 | 0.78 | 0.59 | 0.095 | 0.004 | <0.001 | <0.001 | <0.001 | 0.006 |
Butyrivibrio proteoclasticus | 3.25 | 2.78 | 6.78 | 5.68 | 9.08 | 12.1 | 26.2 | 1.617 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 |
Prevotella spp. | 4.96 | 5.66 | 6.36 | 7.74 | 9.81 | 17.5 | 22.2 | 1.330 | <0.001 | <0.001 | <0.001 | <0.001 | 0.038 |
Megasphaera elsdenii | 0.54 | 0.24 | 0.24 | 0.51 | 1.55 | 1.37 | 3.16 | 0.211 | <0.001 | <0.001 | <0.001 | <0.001 | 0.138 |
Ruminococcus albus | 0.035 | 0.027 | 0.014 | 0.005 | 0.004 | 0.004 | 0.002 | 0.003 | <0.001 | <0.001 | <0.001 | <0.001 | 0.039 |
Ruminococcus flavefaciens | 0.52 | 0.23 | 0.16 | 0.18 | 0.08 | 0.03 | 0.02 | 0.034 | <0.001 | <0.001 | <0.001 | <0.001 | 0.016 |
Streptococcus bovis | 0.030 | 0.035 | 0.036 | 0.083 | 0.158 | 0.289 | 0.378 | 0.028 | <0.001 | <0.001 | <0.001 | <0.001 | 0.318 |
Fatty Acid, mg/100 g FA | CON | PLE (mg/kg DM) | SEM | p-ANOVA | Contrast * | ||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
100 | 200 | 400 | 600 | 800 | 1000 | L | Q | C | Log | ||||
C8:0 | 0.11 | 0.08 | 0.09 | 0.15 | 0.10 | 0.08 | 0.05 | 0.0067 | 0.348 | 0.134 | 0.392 | 0.773 | 0.045 |
C10:0 | 0.21 | 0.13 | 0.19 | 0.09 | 0.15 | 0.16 | 0.09 | 0.0154 | 0.457 | 0.41 | 0.195 | 0.109 | 0.032 |
C12:0 | 1.35 | 1.87 | 1.59 | 1.86 | 1.82 | 1.60 | 1.04 | 0.0582 | 0.316 | 0.376 | 0.282 | 0.300 | 0.021 |
C14:0 | 1.36 | 1.41 | 1.53 | 1.65 | 1.60 | 1.48 | 1.24 | 0.0293 | 0.764 | 0.618 | 0.700 | 0.901 | 0.099 |
C14:1 | 0.48 | 0.49 | 0.48 | 0.57 | 0.56 | 0.46 | 0.44 | 0.0184 | 0.196 | 0.375 | 0.184 | 0.080 | 0.046 |
C15:0 | 1.22 | 1.22 | 1.22 | 1.22 | 1.28 | 1.18 | 1.17 | 0.0246 | 0.901 | 0.195 | 0.101 | 0.054 | 0.001 |
C16:0 | 25.4 | 24.1 | 23.7 | 24.5 | 23.6 | 24.1 | 23.1 | 0.152 | 0.884 | 0.218 | 0.709 | 0.786 | 0.054 |
C16:1 | 0.46 | 0.44 | 0.43 | 0.44 | 0.45 | 0.40 | 0.39 | 0.0089 | 0.947 | 0.92 | 0.66 | 0.385 | 0.040 |
C17:0 | 0.66 | 0.76 | 0.71 | 0.65 | 0.67 | 0.66 | 0.60 | 0.0153 | 0.647 | 0.151 | 0.132 | 0.122 | 0.031 |
C18:0 | 29.4 | 28.8 | 29.4 | 27.7 | 26.1 | 25.3 | 24.1 | 0.318 | 0.273 | 0.712 | 0.221 | 0.078 | <0.001 |
C18:1 trans-10 | 0.76 | 0.84 | 0.93 | 0.95 | 1.53 | 1.60 | 1.70 | 0.046 | 0.067 | 0.879 | 0.338 | 0.097 | 0.004 |
C18:1 cis-9 | 11.3 | 12.0 | 12.1 | 11.5 | 11.5 | 11.1 | 12.4 | 0.295 | 0.776 | 0.888 | 0.948 | 0.787 | 0.120 |
C18:1 cis-12 | 0.51 | 0.48 | 0.47 | 0.42 | 0.47 | 0.48 | 0.44 | 0.010 | 0.842 | 0.282 | 0.293 | 0.289 | 0.037 |
C18:2 cis-9, cis-12 | 8.25 | 8.28 | 8.22 | 10.0 | 11.3 | 12.5 | 14.6 | 0.308 | 0.050 | 0.97 | 0.375 | 0.148 | 0.047 |
C18:3 cis-9, cis-12, cis-15 | 0.87 | 1.10 | 1.21 | 1.24 | 1.55 | 1.68 | 2.05 | 0.082 | 0.026 | 0.589 | 0.899 | 0.554 | 0.049 |
C18:2 cis-9, trans-11 | 0.04 | 0.08 | 0.06 | 0.08 | 0.05 | 0.03 | 0.02 | 0.0033 | 0.881 | 0.557 | 0.545 | 0.572 | 0.032 |
C18:2 trans-10, cis-12 | 0.07 | 0.15 | 0.23 | 0.20 | 0.25 | 0.27 | 0.28 | 0.011 | 0.086 | 0.834 | 0.292 | 0.057 | 0.001 |
C18:3n-6 | 0.44 | 0.36 | 0.35 | 0.61 | 0.44 | 0.39 | 0.35 | 0.017 | 0.027 | 0.026 | 0.074 | 0.194 | 0.045 |
Sum of other FA # | 17.07 | 17.3 | 17.1 | 16.1 | 16.6 | 16.7 | 16.1 | 0.450 | 0.792 | 0.003 | 0.017 | 0.046 | 0.050 |
Sum of SFA | 65.0 | 63.9 | 63.5 | 61.8 | 59.8 | 59.3 | 55.4 | 0.424 | 0.589 | 0.946 | 0.268 | 0.068 | 0.007 |
Sum of UFA | 35.0 | 36.1 | 36.5 | 38.2 | 40.2 | 40.7 | 44.6 | 0.424 | 0.438 | 0.946 | 0.268 | 0.068 | 0.005 |
Sum of MUFA | 25.1 | 26.0 | 26.3 | 25.9 | 26.5 | 25.7 | 27.3 | 0.245 | 0.805 | 0.876 | 0.498 | 0.279 | 0.019 |
Sum of PUFA | 9.86 | 10.1 | 10.2 | 12.4 | 13.7 | 15.0 | 17.4 | 0.348 | 0.051 | 0.978 | 0.384 | 0.146 | 0.041 |
Sum of n-6 FA | 9.20 | 9.13 | 9.04 | 11.1 | 12.2 | 13.4 | 15.4 | 0.303 | 0.067 | 0.842 | 0.299 | 0.114 | 0.044 |
Sum of n-3 FA | 0.87 | 1.10 | 1.21 | 1.24 | 1.55 | 1.68 | 2.05 | 0.082 | 0.047 | 0.589 | 0.899 | 0.554 | 0.032 |
n-6/n-3 FA ratio | 10.8 | 8.4 | 8.4 | 11.2 | 11.3 | 8.09 | 9.63 | 0.489 | 0.097 | 0.316 | 0.501 | 0.709 | 0.051 |
Sum of n-6 PUFA | 8.69 | 8.65 | 8.57 | 10.6 | 11.7 | 12.9 | 14.9 | 0.304 | 0.128 | 0.871 | 0.318 | 0.124 | 0.008 |
Sum of n-3 PUFA | 0.87 | 1.10 | 1.21 | 1.24 | 1.55 | 1.68 | 2.05 | 0.082 | 0.041 | 0.589 | 0.899 | 0.554 | 0.011 |
PUFA/SFA ratio | 0.15 | 0.16 | 0.16 | 0.20 | 0.23 | 0.25 | 0.32 | 0.0071 | 0.052 | 0.879 | 0.432 | 0.156 | 0.009 |
LNA/LA ratio | 0.11 | 0.14 | 0.15 | 0.13 | 0.15 | 0.14 | 0.14 | 0.0071 | 0.910 | 0.405 | 0.609 | 0.778 | 0.199 |
Sum of C18:1 | 20.9 | 22.1 | 22.4 | 21.9 | 22.7 | 22.3 | 23.8 | 0.284 | 0.785 | 0.792 | 0.349 | 0.149 | 0.002 |
Sum of trans C18:1 | 6.91 | 7.50 | 7.66 | 7.82 | 8.70 | 8.63 | 8.76 | 0.120 | 0.397 | 0.422 | 0.057 | 0.009 | <0.001 |
Sum of cis C18:1 | 14.0 | 14.6 | 14.7 | 14.1 | 14.03 | 13.7 | 15.0 | 0.306 | 0.645 | 0.945 | 0.897 | 0.742 | 0.243 |
Sum of MCFA | 36.7 | 36.1 | 34.8 | 35.1 | 34.6 | 34.6 | 32.1 | 0.251 | 0.368 | 0.617 | 0.778 | 0.375 | 0.021 |
Sum of LCFA | 63.0 | 63.7 | 64.9 | 64.7 | 65.1 | 65.2 | 67.8 | 0.256 | 0.591 | 0.631 | 0.74 | 0.337 | 0.034 |
DI | 0.167 | 0.179 | 0.178 | 0.174 | 0.179 | 0.173 | 0.196 | 0.0038 | 0.834 | 0.741 | 0.967 | 0.726 | 0.398 |
DI C14:1 cis- 9/(C14:0+C14:1 cis-9) | 0.26 | 0.26 | 0.24 | 0.25 | 0.26 | 0.24 | 0.26 | 0.006 | 0.939 | 0.315 | 0.173 | 0.101 | 0.002 |
DI C16:1 cis-9/(C16:0+C16:1 cis-9) | 0.018 | 0.018 | 0.018 | 0.018 | 0.019 | 0.017 | 0.017 | 0.00034 | 0.991 | 0.845 | 0.631 | 0.472 | 0.019 |
DI C18:1 cis-9/(C18:0+C18:1 cis-9) | 0.27 | 0.29 | 0.29 | 0.29 | 0.30 | 0.30 | 0.34 | 0.0064 | 0.846 | 0.879 | 0.718 | 0.452 | 0.044 |
DI RA/(VA+RA) | 0.009 | 0.014 | 0.012 | 0.014 | 0.008 | 0.005 | 0.004 | 0.0006 | 0.730 | 0.562 | 0.702 | 0.83 | 0.656 |
Target | Primer Sequence (5′ to 3′) | Reference |
---|---|---|
Ruminococcus flavefaciens | F: CGAACGGAGATAATTTGAGTTTACTTAGG | [48] |
R: CGGTCTCTGTATGTTATGAGGTATTACC | ||
Fibrobacter succinogenes | F: GTTCGGAATTACTGGGCGTAAA | [49] |
R: CGCCTGCCCCTGAACTATC | ||
Streptococcus bovis | F: TTCCTAGAGATAGGAAGTTTCTTCGG | [50] |
R: ATGATGGCAACTAACAATAGGGGT | ||
Prevotella spp. | F: GAAGGTCCCCCACATTG | [50] |
R: CAATCGGAGTTCTTCGTG | ||
Butyrivibrio proteoclasticus | F: TCCTAGTGTAGCGGTGAAATG | [51] |
R: TTAGCGACGGCACTGAATGCCTA | ||
Ruminococcus albus | F: CCCTAAAAGCAGTCTTAGTTCG | [52] |
R CCTCCTTGCGGTTAGAACA | ||
Butyrivibrio fibrisolvens | F: ACACACCGCCCGTCACA | [53] |
R: TCCTTACGGTTGGGTCACAGA | ||
Anaerovibrio lipolytica | F: GAAATGGATTCTAGTGGCAAACG | [54] |
R: ACATCGGTCATGCGACCAA | ||
Megasphaera elsdenii | F: AGATGGGGACAACAGCTGGA | [50] |
R: CGAAAGCTCCGAAGAGCCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nowak, B.; Moniuszko-Szajwaj, B.; Skorupka, M.; Puchalska, J.; Kozłowska, M.; Bocianowski, J.; Kołodziejski, P.A.; Szumacher-Strabel, M.; Patra, A.K.; Stochmal, A.; et al. Effect of Paulownia Leaves Extract Levels on In Vitro Ruminal Fermentation, Microbial Population, Methane Production, and Fatty Acid Biohydrogenation. Molecules 2022, 27, 4288. https://doi.org/10.3390/molecules27134288
Nowak B, Moniuszko-Szajwaj B, Skorupka M, Puchalska J, Kozłowska M, Bocianowski J, Kołodziejski PA, Szumacher-Strabel M, Patra AK, Stochmal A, et al. Effect of Paulownia Leaves Extract Levels on In Vitro Ruminal Fermentation, Microbial Population, Methane Production, and Fatty Acid Biohydrogenation. Molecules. 2022; 27(13):4288. https://doi.org/10.3390/molecules27134288
Chicago/Turabian StyleNowak, Bogumiła, Barbara Moniuszko-Szajwaj, Maria Skorupka, Julia Puchalska, Martyna Kozłowska, Jan Bocianowski, Paweł Antoni Kołodziejski, Małgorzata Szumacher-Strabel, Amlan Kumar Patra, Anna Stochmal, and et al. 2022. "Effect of Paulownia Leaves Extract Levels on In Vitro Ruminal Fermentation, Microbial Population, Methane Production, and Fatty Acid Biohydrogenation" Molecules 27, no. 13: 4288. https://doi.org/10.3390/molecules27134288
APA StyleNowak, B., Moniuszko-Szajwaj, B., Skorupka, M., Puchalska, J., Kozłowska, M., Bocianowski, J., Kołodziejski, P. A., Szumacher-Strabel, M., Patra, A. K., Stochmal, A., & Cieslak, A. (2022). Effect of Paulownia Leaves Extract Levels on In Vitro Ruminal Fermentation, Microbial Population, Methane Production, and Fatty Acid Biohydrogenation. Molecules, 27(13), 4288. https://doi.org/10.3390/molecules27134288