<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xml:lang="en" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">biomolecules</journal-id>
      <journal-title>Biomolecules</journal-title>
      <abbrev-journal-title abbrev-type="publisher">Biomolecules</abbrev-journal-title>
      <abbrev-journal-title abbrev-type="pubmed">Biomolecules</abbrev-journal-title>
      <issn pub-type="epub">2218-273X</issn>
      <publisher>
        <publisher-name>MDPI</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.3390/biom3010108</article-id>
      <article-id pub-id-type="publisher-id">biomolecules-03-00108</article-id>
      <article-categories>
        <subj-group>
          <subject>Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Application of Metabolic <sup>13</sup>C Labeling in Conjunction with High-Field Nuclear Magnetic Resonance Spectroscopy for Comparative Conformational Analysis of High Mannose-Type Oligosaccharides</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Kamiya</surname>
            <given-names>Yukiko</given-names>
          </name>
          <xref rid="af1-biomolecules-03-00108" ref-type="aff">1</xref>
          <xref rid="af2-biomolecules-03-00108" ref-type="aff">2</xref>
          <xref rid="fn1-biomolecules-03-00108" ref-type="fn">†</xref>
          <xref rid="fn2-biomolecules-03-00108" ref-type="corresp">ǂ</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Yanagi</surname>
            <given-names>Kotaro</given-names>
          </name>
          <xref rid="af1-biomolecules-03-00108" ref-type="aff">1</xref>
          <xref rid="af2-biomolecules-03-00108" ref-type="aff">2</xref>
          <xref rid="fn1-biomolecules-03-00108" ref-type="fn">†</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Kitajima</surname>
            <given-names>Toshihiko</given-names>
          </name>
          <xref rid="af3-biomolecules-03-00108" ref-type="aff">3</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Yamaguchi</surname>
            <given-names>Takumi</given-names>
          </name>
          <xref rid="af1-biomolecules-03-00108" ref-type="aff">1</xref>
          <xref rid="af2-biomolecules-03-00108" ref-type="aff">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Chiba</surname>
            <given-names>Yasunori</given-names>
          </name>
          <xref rid="af3-biomolecules-03-00108" ref-type="aff">3</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Kato</surname>
            <given-names>Koichi</given-names>
          </name>
          <xref rid="af1-biomolecules-03-00108" ref-type="aff">1</xref>
          <xref rid="af2-biomolecules-03-00108" ref-type="aff">2</xref>
          <xref rid="af4-biomolecules-03-00108" ref-type="aff">4</xref>
          <xref rid="af5-biomolecules-03-00108" ref-type="aff">5</xref>
          <xref rid="af6-biomolecules-03-00108" ref-type="aff">6</xref>
          <xref rid="c1-biomolecules-03-00108" ref-type="corresp">*</xref>
        </contrib>
      </contrib-group>
      <aff id="af1-biomolecules-03-00108"><label>1 </label>Institute for Molecular Science and Okazaki Institute for Integrative Bioscience, National Institutes of Natural Sciences, 5-1 Higashiyama Myodaiji, Okazaki 444-8787, Japan; E-Mails: <email>yukikok@mol.nagoya-u.ac.jp</email> (Y.K.); <email>kyanagi@ims.ac.jp</email> (K.Y.); <email>takumi@ims.ac.jp</email> (T.Y.)</aff>
      <aff id="af2-biomolecules-03-00108"><label>2 </label>Graduate School of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya 467-8603, Japan</aff>
      <aff id="af3-biomolecules-03-00108"><label>3 </label>Research Center for Medical Glycoscience, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba Central 6, 1-1-1 Higashi, Tsukuba, Ibaraki 305-8566, Japan; E-Mails: <email>kitajima@micro.biol.ethz.ch</email> (T.K.); <email>y-chiba@aist.go.jp</email> (Y.C.)</aff>
      <aff id="af4-biomolecules-03-00108"><label>4 </label>The Glycoscience Institute, Ochanomizu University, 2-1-1 Ohtsuka, Bunkyo-ku, Tokyo 112-8610, Japan</aff>
      <aff id="af5-biomolecules-03-00108"><label>5 </label>Systems and Structural Biology Center, RIKEN, 1-7-22 Suehiro, Tsurumi, Yokohama 230-0045, Japan</aff>
      <aff id="af6-biomolecules-03-00108"><label>6 </label>GLYENCE Co., Ltd./2-22-8 Chikusa, Chikusa-ku, Nagoya 464-0858, Japan</aff>
      <author-notes>
        <fn id="fn1-biomolecules-03-00108">
          <label>† </label>
          <p>These authors contributed equally to this work.</p>
        </fn>
        <fn id="fn2-biomolecules-03-00108">
          <label>ǂ </label>
          <p>Present address: Y.K., Graduate School of Engineering, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603, Japan.</p>
        </fn>
        <corresp id="c1-biomolecules-03-00108"><label>*</label> Author to whom correspondence should be addressed; E-Mail: <email>kkatonmr@ims.ac.jp</email> (K.K.); Tel.: +81-564-59-5225; Fax: +81-564-59-5224.</corresp>
      </author-notes>
      <pub-date pub-type="epub">
        <day>25</day>
        <month>01</month>
        <year>2013</year>
      </pub-date>
      <pub-date pub-type="collection">
        <month>03</month>
        <year>2013</year>
      </pub-date>
      <volume>3</volume>
      <issue>1</issue>
      <fpage>108</fpage>
      <lpage>123</lpage>
      <history>
        <date date-type="received">
          <day>19</day>
          <month>12</month>
          <year>2012</year>
        </date>
        <date date-type="rev-recd">
          <day>10</day>
          <month>01</month>
          <year>2013</year>
        </date>
        <date date-type="accepted">
          <day>15</day>
          <month>01</month>
          <year>2013</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© 2013 by the authors; licensee MDPI, Basel, Switzerland.</copyright-statement>
        <copyright-year>2013</copyright-year>
        <license xmlns:xlink="http://www.w3.org/1999/xlink" license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/3.0/">
          <p>This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).</p>
        </license>
      </permissions>
      <abstract>
        <p>High mannose-type oligosaccharides are enzymatically trimmed in the endoplasmic reticulum, resulting in various processing intermediates with exposed glycotopes that are recognized by a series of lectins involved in glycoprotein fate determination in cells. Although recent crystallographic data have provided the structural basis for the carbohydrate recognition of intracellular lectins, atomic information of dynamic oligosaccharide conformations is essential for a quantitative understanding of the energetics of carbohydrate–lectin interactions. Carbohydrate NMR spectroscopy is useful for characterizing such conformational dynamics, but often hampered by poor spectral resolution and lack of recombinant techniques required to produce homogeneous glycoforms. To overcome these difficulties, we have recently developed a methodology for the preparation of a homogeneous high mannose-type oligosaccharide with <sup>13</sup>C labeling using a genetically engineered yeast strain. We herein successfully extended this method to result in the overexpression of <sup>13</sup>C-labeled Man<sub>9</sub>GlcNAc<sub>2</sub> (M9) with a newly engineered yeast strain with the deletion of four genes involved in <italic>N</italic>-glycan processing. This enabled high-field NMR analyses of <sup>13</sup>C-labeled M9 in comparison with its processing product lacking the terminal mannose residue Man<italic>D2</italic>. Long-range NOE data indicated that the outer branches interact with the core in both glycoforms, and such foldback conformations are enhanced upon the removal of Man<italic>D2</italic>. The observed conformational variabilities might be significantly associated with lectins and glycan-trimming enzymes.</p>
      </abstract>
      <kwd-group>
        <kwd>nuclear magnetic resonance spectroscopy</kwd>
        <kwd>high mannose-type oligosaccharide</kwd>
        <kwd>stable isotope labeling</kwd>
        <kwd>
          <italic>Saccharomyces cerevisiae</italic>
        </kwd>
        <kwd>nuclear Overhauser effect</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec sec-type="intro">
      <title>1. Introduction</title>
      <p>The carbohydrate chains that modify proteins play key roles in a variety of physiological and pathological functions, such as intercellular communications, viral infections and immune reactions [<xref ref-type="bibr" rid="B1-biomolecules-03-00108">1</xref>]. These biological processes involve molecular recognition mediated by carbohydrate–protein and carbohydrate–carbohydrate interactions, which can be potential therapeutic targets [<xref ref-type="bibr" rid="B2-biomolecules-03-00108">2</xref>,<xref ref-type="bibr" rid="B3-biomolecules-03-00108">3</xref>,<xref ref-type="bibr" rid="B4-biomolecules-03-00108">4</xref>,<xref ref-type="bibr" rid="B5-biomolecules-03-00108">5</xref>]. In addition to these extracellular events, accumulating evidence has indicated that high mannose-type oligosaccharides displayed on proteins are actively involved in glycoprotein fate determination processes in cells, such as folding, translocation and degradation, through interactions with a series of intracellular lectins [<xref ref-type="bibr" rid="B6-biomolecules-03-00108">6</xref>,<xref ref-type="bibr" rid="B7-biomolecules-03-00108">7</xref>,<xref ref-type="bibr" rid="B8-biomolecules-03-00108">8</xref>]. In the endoplasmic reticulum (ER), a nascent polypeptide chain is covalently linked to the triantennary oligosaccharide, Glc<sub>3</sub>Man<sub>9</sub>GlcNAc<sub>2</sub> (G3M9), which is subsequently trimmed by glucosidases and mannosidases to result in a variety of high mannose-type oligosaccharides. These processing intermediates exhibit specific glycotopes that are recognized by intracellular lectins functioning as molecular chaperones and cargo receptors and by those involved in ER-associated protein degradation. Namely, the glycotopes as fate determinants of glycoproteins are embedded in the triantennary structure of G3M9 and exposed with trimming by the ER enzymes.</p>
      <p>The recently emerged crystal structures of the intracellular lectins complexed with oligosaccharides have provided atomic pictures demonstrating the mechanisms by which glycotopes are recognized by the lectins [<xref ref-type="bibr" rid="B8-biomolecules-03-00108">8</xref>]. In general, however, the oligosaccharides have significant degrees of internal motions [<xref ref-type="bibr" rid="B9-biomolecules-03-00108">9</xref>]. For the quantitative evaluation of the energetics of carbohydrate–lectin interactions, it is essential to understand the conformational dynamics of the oligosaccharides in their free forms, as well as in their lectin-bound forms.</p>
      <p>NMR spectroscopy is undoubtedly a powerful method to provide atomic information on the conformations, dynamics and interactions of oligosaccharides in solution. However, NMR studies of oligosaccharide structures remain challenging compared to those of proteins, because of the poor spectral resolutions resulting from the small variations in the functional groups and the lack of a recombinant technique to produce homogenous glycoforms in sufficient quantities [<xref ref-type="bibr" rid="B10-biomolecules-03-00108">10</xref>]. To overcome these difficulties, we have recently developed a methodology for the overexpression of a homogeneous high mannose-type oligosaccharide with <sup>13</sup>C labeling with a genetically engineered yeast strain [<xref ref-type="bibr" rid="B11-biomolecules-03-00108">11</xref>].</p>
      <p>In the ER of yeast, G3M9 is trimmed by glycosidases I and II, resulting in the Man<sub>9</sub>GlcNAc<sub>2</sub> (M9) glycoform, which is then converted to the Manα1-2Manα1-6(Manα1-3)Manα1-6(Manα1-2Manα1-2Manα1-3)Manβ1-4GlcNAcβ1-4GlcNAc glycoform (abbreviated as M8B) by the removal of the terminal mannose residue (<italic>D2</italic>) of the central branch by the action of ER α-mannosidase [<xref ref-type="bibr" rid="B12-biomolecules-03-00108">12</xref>] (<xref ref-type="fig" rid="biomolecules-03-00108-f001">Figure 1</xref>). Subsequently, glycoproteins exhibiting the M8B glycan are transported from the ER to the Golgi, where the glycan is hypermannosylated by α1-2-, α1-3- and α1-6-mannosyl transferases and phosphorylated by mannosylphosphate transferase [<xref ref-type="bibr" rid="B12-biomolecules-03-00108">12</xref>]. Therefore, the M8B glycoform could exclusively accumulate in yeast by knocking out the genes encoding α1-3- and α1-6-mannosyl transferases (termed <italic>MNN1</italic> and <italic>OCH1</italic>, respectively), along with <italic>MNN4</italic>, which encodes a positive regulator of mannosylphosphate transferase [<xref ref-type="bibr" rid="B13-biomolecules-03-00108">13</xref>,<xref ref-type="bibr" rid="B14-biomolecules-03-00108">14</xref>]. By metabolic labeling with this engineered yeast strain, we have successfully prepared high yields of uniformly or site-selectively <sup>13</sup>C-labeled M8B oligosaccharides of suitable homogeneity [<xref ref-type="bibr" rid="B11-biomolecules-03-00108">11</xref>].</p>
      <p>In the present study, we extended this methodology to the production of isotopically labeled M9 oligosaccharide. By comparing the NMR spectral data of <sup>13</sup>C-labeled M8B and M9 collected at higher magnetic fields beyond 900 MHz of the proton observation frequency, the conformational impact of the removal of the mannose residue was examined at an atomic level.</p>
    </sec>
    <sec sec-type="results">
      <title>2. Results</title>
      <sec>
        <title>2.1. Overexpression of <sup>13</sup>C-Labeled M9</title>
        <p>In yeast, the <italic>N</italic>-glycan processing pathways in the ER converge to generate the M9 glycoform, which is subsequently converted to M8B by ER α-mannosidase encoded by <italic>MNS1</italic>. Therefore, it was anticipated that the knocking out of this gene, in addition to <italic>MNN1</italic>, <italic>MNN4</italic> and <italic>OCH1</italic>, resulting in the accumulation of glycoproteins exclusively displaying M9. According to this idea, we made the Δ<italic>och1</italic> Δ<italic>mnn1</italic> Δ<italic>mnn4</italic> Δ<italic>mns1</italic> quadruple mutant of <italic>Saccharomyces cerevisiae</italic>. The engineered yeast cells were cultivated in a medium containing <sup>13</sup>C-labeled glucose, instead of the conventional YPAD medium. From the glycoprotein mixture harvested from the cells, <italic>N</italic>-linked oligosaccharides were released by hydrazinolysis, re-<italic>N</italic>-acetylated with <sup>13</sup>C-labeled acetic anhydride and subsequently fluorescence-labeled with 2-aminopyridine. The pyridylamino (PA) derivatives were subjected to high-performance liquid chromatography (HPLC), which demonstrated that the major <italic>N</italic>-linked oligosaccharide was identified as M9 based on the elution times (<xref ref-type="fig" rid="biomolecules-03-00108-f002">Figure 2</xref>). This result was confirmed by MS. The typical yields of PA-M9 with <sup>13</sup>C labeling were 380 nmol/liter of cell culture. </p>
      <fig id="biomolecules-03-00108-f001" position="float">
        <label>Figure 1</label>
        <caption>
          <p><bold>(a)</bold> Schematic representation of Man<sub>9</sub>GlcNAc<sub>2</sub> showing the linkage and branching patterns, together with the residue numbering scheme. <bold>(b)</bold> Scheme showing the processing pathway of <italic>N</italic>-linked oligosaccharide (adapted from reference [<xref ref-type="bibr" rid="B11-biomolecules-03-00108">11</xref>] with modifications).</p>
        </caption>
        <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="biomolecules-03-00108-g001.tif"/>
      </fig>
        <fig id="biomolecules-03-00108-f002" position="float">
          <label>Figure 2</label>
          <caption>
            <p>Elution profile of the pyridylamino (PA) derivative of <italic>N</italic>-linked oligosaccharides derived from the engineered <italic>S. cerevisiae</italic> cells on an Amide-80 column. The fraction indicated by the arrow corresponds to the PA derivative of Man<sub>9</sub>GlcNAc<sub>2</sub> (M9), while those indicated by an asterisk contain no detectable oligosaccharides.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="biomolecules-03-00108-g002.tif"/>
        </fig>
      </sec>
      <sec>
        <title>2.2. <sup>1</sup>H-<sup>13</sup>C HSQC Spectral Comparison of M8B and M9</title>
        <p>Because we already established the protocol for the preparation of <sup>13</sup>C-labeled M8B, the aforementioned success in the overexpression of <sup>13</sup>C-labeled M9 enabled us to perform comparative conformational analyses of these two glycoforms with stable isotope-assisted NMR methods. <xref ref-type="fig" rid="biomolecules-03-00108-f003">Figure 3</xref> compares the <sup>1</sup>H-<sup>13</sup>C HSQC spectra of the PA derivatives of the isotopically labeled M8B and M9 oligosaccharides. The spectral assignments were made using <sup>1</sup>H-<sup>13</sup>C HSQC TOCSY and H2BC data in conjunction with position-selective <sup>13</sup>C metabolic labeling (<xref ref-type="fig" rid="biomolecules-03-00108-f003">Figure 3</xref>a). </p>
        <fig id="biomolecules-03-00108-f003" position="float">
          <label>Figure 3</label>
          <caption>
            <p><bold>(a)</bold><sup> 1</sup>H-<sup>13</sup>C Heteronuclear Single Quantum Coherence (HSQC) spectra of the PA derivative of M9, metabolically <sup>13</sup>C-labeled with D-[1-<sup>13</sup>C]glucose (<italic>black</italic>), D-[2-<sup>13</sup>C]glucose (<italic>blue</italic>), D-[3-<sup>13</sup>C]glucose (<italic>green</italic>), D-[4-<sup>13</sup>C]glucose (<italic>magenta</italic>), D-[5-<sup>13</sup>C]glucose (<italic>orange</italic>) or D-[6-<sup>13</sup>C]glucose (<italic>cyan</italic>). The six spectra were superposed and the <sup>13</sup>C-labeled positions in the glucose isotopomers used as metabolic precursors are shown with circles in the same colors as the corresponding spectra. <sup>1</sup>H-<sup>13</sup>C HSQC experiments were performed at a proton observation frequency of 920.7 MHz with 256 (<italic>t</italic><sub>1</sub>) × 1024 (<italic>t</italic><sub>2</sub>) complex points and 16 scans per <italic>t</italic><sub>1</sub> increment. The spectrum widths were 15.1 kHz for the <sup>13</sup>C dimension and 5.8 kHz for the <sup>1</sup>H dimension. <bold>(b)</bold><sup> 1</sup>H-<sup>13</sup>C HSQC spectra of the PA derivative of M9 (<italic>black</italic>) and Manα1-2Manα1-6(Manα1-3)Manα1-6(Manα1-2Manα1-2Manα1-3)Manβ1-4GlcNAcβ1-4GlcNAc glycoform (M8B) (<italic>red</italic>) uniformly labeled with <sup>13</sup>C.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="biomolecules-03-00108-g003.tif"/>
        </fig>
        <p>The chemical shift values are summarized in Table S1. Significant chemical shift differences were observed not only in the Man<italic>A</italic> residue, which is exposed as the nonreducing terminus in M8B, but also in the inner core parts (<xref ref-type="fig" rid="biomolecules-03-00108-f003">Figure 3</xref>b). These data suggested that the removal of the Man<italic>D2</italic> residue induces overall conformational rearrangements of the triantennary structure.</p>
        <p>We also measured one-bond <sup>13</sup>C-<sup>1</sup>H spin-coupling constants (<sup>1</sup><italic>J</italic><sub>C1,H1</sub>) for the anomeric group of each mannose residue on the basis of <italic>F</italic><sub>2</sub>-coupled <sup>1</sup>H-<sup>13</sup>C HSQC spectra of the PA-derivatives of M9 and M8B metabolically <sup>13</sup>C-labeled with D-[1-<sup>13</sup>C]glucose (<xref ref-type="table" rid="biomolecules-03-00108-t001">Table 1</xref>). Besides Man<italic>A</italic>, Man<italic>3</italic> and Man<italic>4’</italic> exhibited small, but significant, differences in the <sup>1</sup><italic>J</italic><sub>C1,H1</sub> value between M9 and M8B. Since <sup>1</sup><italic>J</italic><sub>C1,H1</sub> depends on C-H bond length and orientation, as well as glycosidic linkage conformation [<xref ref-type="bibr" rid="B15-biomolecules-03-00108">15</xref>,<xref ref-type="bibr" rid="B16-biomolecules-03-00108">16</xref>], the observed differences again indicated some distal effects of the Man<italic>D2</italic> elimination.</p>
        <table-wrap id="biomolecules-03-00108-t001" position="float">
          <object-id pub-id-type="pii">biomolecules-03-00108-t001_Table 1</object-id>
          <label>Table 1</label>
          <caption>
            <p><sup>1</sup><italic>J</italic><sub>C1,H1</sub> values (Hz) of PA-M8B and PA-M9 metabolically labeled with D-[1-<sup>13</sup>C]glucose.<italic><sup> a</sup></italic></p>
          </caption>
          <table>
            <thead>
              <tr>
                <th align="left" valign="middle"> </th>
                <th align="left" valign="middle">M8B</th>
                <th align="left" valign="middle">M9</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td align="left" valign="middle">Man<italic>3</italic></td>
                <td align="left" valign="middle">161.13 ± 0.02</td>
                <td align="left" valign="middle">160.86 ± 0.01</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>4</italic></td>
                <td align="left" valign="middle">172.93 ± 0.05</td>
                <td align="left" valign="middle">172.77 ± 0.04</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>C</italic></td>
                <td align="left" valign="middle">172.72 ± 0.05</td>
                <td align="left" valign="middle">172.70 ± 0.04</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>D1</italic></td>
                <td align="left" valign="middle">
                  <italic>171<sup>b</sup></italic>
                </td>
                <td align="left" valign="middle">171.38 ± 0.02</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>4'</italic></td>
                <td align="left" valign="middle">171.46 ± 0.01</td>
                <td align="left" valign="middle">171.73 ± 0.06</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>A</italic></td>
                <td align="left" valign="middle">171.51 ± 0.07</td>
                <td align="left" valign="middle">173.03 ± 0.02</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>D2</italic></td>
                <td align="left" valign="middle"> </td>
                <td align="left" valign="middle">171.26 ± 0.05</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>B</italic></td>
                <td align="left" valign="middle">172.33 ± 0.03</td>
                <td align="left" valign="middle">172.24 ± 0.09</td>
              </tr>
              <tr>
                <td align="left" valign="middle">Man<italic>D3</italic></td>
                <td align="center" valign="middle">
                  <italic>171<sup>b</sup></italic>
                </td>
                <td align="left" valign="middle">171.15 ± 0.08</td>
              </tr>
            </tbody>
          </table>
		  <table-wrap-foot>
			<fn>
        <p><italic><sup>a </sup>F</italic><sub>2</sub><italic>-</italic>coupled <sup>1</sup>H-<sup>13</sup>C HSQC experiments were performed at a proton observation frequency of 920.7 MHz with 32 (<italic>t</italic><sub>1</sub>) × 65536 (<italic>t</italic><sub>2</sub>) complex points and 12 scans per <italic>t</italic><sub>1</sub> increment. The spectral widths were 2.3 kHz for the <sup>13</sup>C dimension and 2.3 kHz for the <sup>1</sup>H dimension. <sup>1</sup><italic>J</italic><sub>C1,H1 </sub>values are the mean ± S.D. of three independent experiments.</p>
        <p><italic><sup>b </sup></italic>Coupling constants that could not be determined accurately due to overlap are shown in <italic>italics.</italic></p>
			</fn>
			</table-wrap-foot>
        </table-wrap>
      </sec>
      <sec>
        <title>2.3. Interresidue NOE Connectivities of M8B and M9</title>
        <p>In order to characterize the conformational differences between M8B and M9 with a more quantitative interpretation, we conducted <sup>13</sup>C-edited NOESY experiments at a proton observation frequency of 950.3 MHz with the isotopically labeled PA oligosaccharides. As exemplified by <xref ref-type="fig" rid="biomolecules-03-00108-f004">Figure 4</xref>, not only intraresidue and interglycosidic NOEs, but also long-range NOEs, were observed exhibiting different patterns between M8B and M9. We quantified the NOE intensities by inspecting the NOE build-up curves. The results are summarized in <xref ref-type="fig" rid="biomolecules-03-00108-f005">Figure 5</xref> and Table S2. These data clearly demonstrate that the outer branches, especially those associated with Man<italic>4’</italic>, are folded back toward the reducing end in both M8B and M9. Intriguingly, the NOE connectivity networks were significantly different between these two species, indicating gross conformational rearrangement of the triantennary structure upon the removal of Man<italic>D2</italic>, which resulted in the enhancement of the foldback conformation in M8B.</p>
        <fig id="biomolecules-03-00108-f004" position="float">
          <label>Figure 4</label>
          <caption>
            <p>Part of the <sup>13</sup>C-edited Nuclear Overhauser effect spectroscopy (NOESY) spectra of the PA derivatives of M8B and M9 uniformly labeled with <sup>13</sup>C, showing connectivities from (a) GlcNAc<italic>2</italic>-Ac and (b) Man<italic>B</italic>-H<sub>2</sub>. The spectrum was recorded at a proton observation frequency of 950.3 MHz with 64 (<italic>t</italic><sub>1</sub>) × 80 (<italic>t</italic><sub>2</sub>) × 1024 (<italic>t</italic><sub>3</sub>) complex points and two scans per <italic>t</italic><sub>1</sub> increment with a mixing time of 200 ms. The number at the top of each slice is the chemical shift of <sup>13</sup>C resonance.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="biomolecules-03-00108-g004.tif"/>
        </fig>
        <fig id="biomolecules-03-00108-f005" position="float">
          <label>Figure 5</label>
          <caption>
            <p>Summary of the long-range Nuclear Overhauser effect (NOE) connectivities identified in the <bold>(a)</bold> M8B and <bold>(b)</bold> M9 oligosaccharides. Interresidue NOEs are shown except for those observed between neighboring residues and those unassigned due to peak overlap. They are classified based on normalized intensity as follows: &gt; 0.2 (solid). 0.2–0.1 (dashed), 0.1–0.03 (dotted).</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="biomolecules-03-00108-g005.tif"/>
        </fig>
      </sec>
    </sec>
    <sec sec-type="discussion">
      <title>3. Discussion</title>
      <p>In the present study, we successfully extended the yeast-engineering methodology to produce <sup>13</sup>C-labeled M9 for detailed NMR analyses. By inspecting the <sup>13</sup>C-edited NOE data, the interactions between the outer branches and the inner core were identified in M8B and M9, the former of which, however, exhibited the foldback conformation more extensively.</p>
      <p>In their pioneering works [<xref ref-type="bibr" rid="B17-biomolecules-03-00108">17</xref>,<xref ref-type="bibr" rid="B18-biomolecules-03-00108">18</xref>], Vliegenthart and coworkers implied the existence of a foldback conformation in the M9 derivative lacking the innermost GlcNAc residue, based on the anomerization effects of reducing terminal GlcNAc<italic>2</italic> on the anomeric proton chemical shifts of Man<italic>D2</italic> and Man<italic>A</italic>, observed as their peak splitting. A more pronounced peak splitting was reported for Man<italic>A</italic> in the M8B derivative without GlcNAc<italic>1</italic>, suggesting that the removal of Man<italic>D2</italic> exposes Man<italic>A</italic>, thereby allowing its interaction with the core GlcNAc<italic>2</italic> residue [<xref ref-type="bibr" rid="B19-biomolecules-03-00108">19</xref>]. These data are qualitatively consistent with the present NOE data obtained with the PA derivatives of M8B and M9.</p>
      <p>The foldback conformation was also identified in the M8B glycan attached to ribonuclease B by observing a long-range NOE between Man<italic>A</italic>-H<sub>1</sub> and GlcNAc<italic>2</italic>-Ac, which was also observed in the present study [<xref ref-type="bibr" rid="B20-biomolecules-03-00108">20</xref>]. Similarly, the heterogeneous high mannose-type <italic>N</italic>-glycans[(Man)<italic><sub>n</sub></italic>GlcNAc<sub>2</sub>, <italic>n</italic> = 5–8] displayed on a soluble form of human CD2 (shCD2) expressed in CHO cells showed long-range NOE connectivities between Man<italic>A</italic>-H<sub>1</sub>/H<sub>2</sub> and GlcNAc<italic>2</italic>-Ac, which, however, were not observed when Man<italic>D2</italic> was present [<xref ref-type="bibr" rid="B21-biomolecules-03-00108">21</xref>,<xref ref-type="bibr" rid="B22-biomolecules-03-00108">22</xref>]. Here, we did not detect the NOE between Man<italic>A</italic>-H<sub>2</sub> and GlcNAc<italic>2</italic>-Ac in M8B (<xref ref-type="fig" rid="biomolecules-03-00108-f005">Figure 5</xref>), and this was probably because the NOE observed in shCD2 originated from its major glycoforms, such as M7 (40%) and M6 (34%) [<xref ref-type="bibr" rid="B21-biomolecules-03-00108">21</xref>]. On the other hand, the undetectability of the long-range Man<italic>A</italic>-GlcNAc NOEs in the presence of Man<italic>D2</italic> was either because of the low abundance of the <italic>D2</italic>-containing glycoform (6%) or a conformational difference [<xref ref-type="bibr" rid="B21-biomolecules-03-00108">21</xref>]. We detected no NOE between Man<italic>D2</italic> and GlcNAc<italic>2</italic> in M9 (<xref ref-type="fig" rid="biomolecules-03-00108-f004">Figure 4</xref>a), supporting a gross conformational rearrangement upon the removal of the terminal <italic>D2</italic> residue.</p>
      <p>The conformational rigidity of M9 has been proposed by inspecting NMR-derived local conformational restraints, such as interglycosidic NOEs and scalar couplings [<xref ref-type="bibr" rid="B23-biomolecules-03-00108">23</xref>,<xref ref-type="bibr" rid="B24-biomolecules-03-00108">24</xref>] and MD simulations in explicit water [<xref ref-type="bibr" rid="B25-biomolecules-03-00108">25</xref>], while <italic>in vacuo</italic> MD simulations have suggested considerable variabilities of the glycosidic angles of M9 [<xref ref-type="bibr" rid="B26-biomolecules-03-00108">26</xref>]. In particular, 1-ns MD simulations in water showed that M9 exhibited conformational fluctuation within a restricted conformational space with maintenance of an extended overall conformation in which several strongly coordinated water molecules mediated interbranch hydrogen bonds [<xref ref-type="bibr" rid="B25-biomolecules-03-00108">25</xref>]. Consistently, our <sup>13</sup>C-edited NOE data identified NOE connectivities among the outer branches of M9 (<xref ref-type="fig" rid="biomolecules-03-00108-f005">Figure 5</xref> and Table S2). However, it should be noted that the present study also indicated intramolecular interactions between the outer branch and core of M9 associated with several long-range NOE connectivities (<xref ref-type="fig" rid="biomolecules-03-00108-f005">Figure 5</xref>), which could not be interpreted solely based on the ensemble of extended conformations. Because NMR parameters, including NOE, provide an average picture of a dynamic conformational ensemble, the long-range NOE connectivities are supposed to reflect transient, minor and foldback conformations assumed by M9, which might be barely detected in the MD simulation that is conducted for a limited period. Such conformational variabilities of M9, as well as of M8B, might be significantly associated with their affinities and specificities for the intracellular lectins and glycan-trimming enzymes.</p>
    </sec>
    <sec>
      <title>4. Experimental Section</title>
      <sec>
        <title>4.1. Yeast Engineering</title>
        <p><italic>S. cerevisiae</italic> TIY19 (<italic>MAT</italic>a <italic>och1</italic>Δ::<italic>hisG mnn1</italic>Δ::<italic>hisG mnn4</italic>Δ::<italic>hisG</italic> <italic>leu2-3</italic>, <italic>112 his3-11 ade2-1 ura3-1 trp1-1 can1-100</italic>) was generated from TIY20 strain (<italic>MAT</italic>α <italic>och1</italic>Δ::<italic>hisG mnn1</italic>Δ::<italic>hisG mnn4</italic>Δ::<italic>hisG leu2-3</italic>, <italic>112 his3-11 ade2-1 ura3-1 trp1-1 can1-100</italic>) [<xref ref-type="bibr" rid="B27-biomolecules-03-00108">27</xref>] by tetrad dissection. <italic>MNS1</italic> disruption was performed by a one-step PCR-mediated technique [<xref ref-type="bibr" rid="B28-biomolecules-03-00108">28</xref>]. In brief, a <italic>TRP1</italic> cassette containing upstream and downstream sequences of the <italic>MNS1</italic> gene was amplified with two primers (mns1-del-f and mns1-del-r, <xref ref-type="table" rid="biomolecules-03-00108-t002">Table 2</xref>) and the plasmid pFA6a-TRP1 as a template. The amplified DNA fragment was transformed into the TIY19 strain using a lithium acetate procedure [<xref ref-type="bibr" rid="B29-biomolecules-03-00108">29</xref>], and the cells were then grown on a SDCA–Trp plate (0.67% yeast nitrogen base without amino acid, 2% glucose, 0.01% adenine hemisulfate, 0.5% casamino acids, 0.3M KCl and 2% agar). In order to identify transformants in which the <italic>TRP1</italic> cassette had been properly integrated, colony direct PCR using two primers (T2.1 and mns1-del-chk, <xref ref-type="table" rid="biomolecules-03-00108-t002">Table 2</xref>) was conducted, and a PCR product of the expected size (605 bp) confirmed <italic>MNS1</italic> deletion of the transformants. </p>
        <table-wrap id="biomolecules-03-00108-t002" position="float">
          <object-id pub-id-type="pii">biomolecules-03-00108-t002_Table 2</object-id>
          <label>Table 2</label>
          <caption>
            <p>Primers used in this study.</p>
          </caption>
          <table>
            <thead>
              <tr>
                <th align="left" valign="middle">Name</th>
                <th align="left" valign="middle">Sequence</th>
              </tr>
            </thead>
            <tbody>
              <tr>
                <td align="left" valign="middle">mns1-del-f</td>
                <td align="left" valign="middle">CAGAAAAAGGTAGTAAAAGAGGAAAAGGTTAAACATTGAAAAAGGATTCTCGGATCCCCGGGTTAATTAA</td>
              </tr>
              <tr>
                <td align="left" valign="middle">mns1-del-r</td>
                <td align="left" valign="middle">CGCATAGTGAATTTTAAAAGGCGAATCTGGCCACTATATAGCACACTAACGAATTCGAGCTCGTTTAAAC</td>
              </tr>
              <tr>
                <td align="left" valign="middle">mns1-del-chk</td>
                <td align="left" valign="middle">AAGTGCAGAGGCGCTATC</td>
              </tr>
              <tr>
                <td align="left" valign="middle">T2.1</td>
                <td align="left" valign="middle">TCTGCAAGCCGCAAACTT</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec>
        <title>4.2. Metabolic Labeling</title>
        <p>The engineered yeast cells were grown in medium containing 0.5% <sup>13</sup>C-labeled D-glucose (Cambridge Isotope Laboratories, Inc. MA, USA) and 0.67% yeast nitrogen base without amino acids (Difco), supplemented with 0.3 M KCl as an osmotic stabilizer for 72 h at 30 °C. The cells were harvested by centrifugation at 5000× <italic>g</italic> for 10 min at 4 °C, washed with distilled water and re-centrifuged. The cells were resuspended in 4 mL of 100 mM citrate buffer (pH 7.0) per 1 g of yeast cells and subsequently lysed by autoclaving at 121 °C for 120 min, according to the literature [<xref ref-type="bibr" rid="B30-biomolecules-03-00108">30</xref>]. After the collection of the supernatant by centrifugation at 8000× <italic>g</italic> for 10 min, three volumes of cold ethanol were added to precipitate the glycoproteins. The collected precipitates were dissolved again with water and then lyophilized for the next reaction. </p>
      </sec>
      <sec>
        <title>4.3. Purification</title>
        <p>In order to release <italic>N</italic>-linked oligosaccharides, lyophilized glycoproteins (15 mg) were resolved in 0.7 mL of hydrazine anhydrous (TCI, Tokyo, Japan) in a 10 mL glass tube, incubated at 95 °C for 8 h and then quenched with 7 mL of 50 mM ammonium acetate buffer (pH 7.0). Excess hydrazine and peptides were removed with a graphite carbon column (GL-Pak Carbograph, GL Sciences Inc., Tokyo, Japan) according to the literature [<xref ref-type="bibr" rid="B31-biomolecules-03-00108">31</xref>]. The oligosaccharide solutions were loaded onto the GL-Pak Carbograph column. After the column was washed with 15 mL of 50 mM ammonium acetate buffer (pH 7.0), the released oligosaccharides were eluted with 5 mL of a mixture of 50 mM ammonium acetate buffer (pH 7.0): acetonitrile (40:60) containing 2% [U-<sup>13</sup>C<sub>4</sub>] acetic anhydride (Cambridge Isotope Laboratories, Inc. MA, USA), which was used for the re-<italic>N</italic>-acetylation of the GlcNAc residues. The eluted oligosaccharides were fluorescently labeled with 2-aminopyridine (Wako Pure Chemical Industries, Ltd., Osaka, Japan) for further purification. The PA oligosaccharides were sequentially fractionated and isolated by HPLC on a TSK-gel Amide-80 column (Tosoh Corporation, Tokyo, Japan) and a Shim-pack HRC ODS column (Shimadzu Corporation, Kyoto, Japan), as described in the literature [<xref ref-type="bibr" rid="B32-biomolecules-03-00108">32</xref>,<xref ref-type="bibr" rid="B33-biomolecules-03-00108">33</xref>,<xref ref-type="bibr" rid="B34-biomolecules-03-00108">34</xref>,<xref ref-type="bibr" rid="B35-biomolecules-03-00108">35</xref>]. The identification of oligosaccharide structures was based on their elution position from these columns in comparison with PA-glycans in the GALAXY database [<xref ref-type="bibr" rid="B32-biomolecules-03-00108">32</xref>,<xref ref-type="bibr" rid="B34-biomolecules-03-00108">34</xref>]. The identification of the M8B and M9 oligosaccharides as PA derivatives were confirmed by MALDI-TOF-MS analyses using Voyager DE-STR (Applied Biosystems).</p>
      </sec>
      <sec>
        <title>4.4. NMR Measurements and Analyses</title>
        <p>Purified oligosaccharides were dissolved in 99.96% D<sub>2</sub>O at a concentration of 0.3 mM. NMR spectra were obtained at 303 K using a JEOL ECA-920 spectrometer or a Bruker Avance-III 950 spectrometer equipped with a cryogenic probe. Chemical shifts of <sup>1</sup>H were referenced to DSS (0 ppm), while <sup>13</sup>C chemical shifts were referenced indirectly, using the gyromagnetic ratios of <sup>13</sup>C (γ<sup>13</sup>C/γ<sup>1</sup>H = 0.25144952). <sup>1</sup>H-<sup>13</sup>C HSQC spectra, H2BC and <sup>1</sup>H-<sup>13</sup>C HSQC-TOCSY were recorded at a proton observation frequency of 920.7 MHz. 3D <sup>13</sup>C-edited NOESY was recorded at a proton observation frequency of 950.3 MHz with mixing times of up to 400 ms. NMR spectra were processed using NMRPipe software [<xref ref-type="bibr" rid="B36-biomolecules-03-00108">36</xref>] and analyzed with SPARKY (T.D. Goddard and D.G. Kneller, SPARKY 3, University of California, San Francisco). </p>
      </sec>
    </sec>
    <sec sec-type="conclusions">
      <title>5. Conclusions</title>
      <p>The method of <sup>13</sup>C labeling combined with high-field NMR spectroscopy has now opened new opportunities for detailed conformational analyses of oligosaccharides. In this study, we successfully observed extensive datasets of long-range NOE connectivities in M8B and M9, which will enable experimental validation of computational simulations for the characterization of dynamic conformational ensembles of these oligosaccharides. To improve the accuracy of the validation, additional experimental data are necessary as sources of long-range geometric information. In previous studies, we demonstrated that pseudocontact shifts observed by paramagnetic lanthanide tagging provide long distance information for validating the conformational ensemble of oligosaccharides derived from MD simulations [<xref ref-type="bibr" rid="B37-biomolecules-03-00108">37</xref>,<xref ref-type="bibr" rid="B38-biomolecules-03-00108">38</xref>]. Paramagnetic relaxation enhancement and residual dipolar coupling are also useful for characterizing the conformational dynamics of oligosaccharides [<xref ref-type="bibr" rid="B39-biomolecules-03-00108">39</xref>,<xref ref-type="bibr" rid="B40-biomolecules-03-00108">40</xref>]. The stable-isotope-labeling technique in conjunction with higher magnetic fields will offer a technical basis to facilitate the collection of these NMR datasets for the elucidation of the conformational dynamics of the high mannose-type oligosaccharides in their free and lectin-bound forms.</p>
    </sec>
  </body>
  <back>
    <ack>
      <title>Acknowledgments</title>
      <p>This paper was dedicated to the memory of Dr. Yoshifumi Jigami. We thank Yukiko Isono (IMS) for her help in the preparation of the oligosaccharide and Dr. Takahisa Ikegami (Osaka University) and Michiko Nakano (IMS) for their help in the NMR measurements. The NMR analyses in this study were performed, in part, using the 950-MHz NMR spectrometer under the Cooperative Research Program of Institute for Protein Research, Osaka University. This work was partly supported by the Nanotechnology Platform Program (Molecule and Material Synthesis) of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan, and Grants in Aid for Scientific Research (20107004 and 24750170) from MEXT of Japan.</p>
    </ack>
    <ref-list>
      <title>References</title>
      <ref id="B1-biomolecules-03-00108">
        <label>1.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Varki</surname>
              <given-names>A.</given-names>
            </name>
          </person-group>
          <article-title>Biological roles of oligosaccharides: all of the theories are correct</article-title>
          <source>Glycobiology</source>
          <year>1993</year>
          <volume>3</volume>
          <fpage>97</fpage>
          <lpage>130</lpage>
          <pub-id pub-id-type="doi">10.1093/glycob/3.2.97</pub-id>
        </citation>
      </ref>
      <ref id="B2-biomolecules-03-00108">
        <label>2.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>von der Lieth</surname>
              <given-names>C.W.</given-names>
            </name>
            <name>
              <surname>Siebert</surname>
              <given-names>H.C.</given-names>
            </name>
            <name>
              <surname>Kožár</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Burchert</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Frank</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Gilleron</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Kaltner</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Kayser</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Tajkhorshid</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Bovin</surname>
              <given-names>N.V.</given-names>
            </name>
            <name>
              <surname>Vliegenthart</surname>
              <given-names>J.F.G.</given-names>
            </name>
            <name>
              <surname>Gabius</surname>
              <given-names>H.J.</given-names>
            </name>
          </person-group>
          <article-title>Lectin ligands: new insights into their conformations and their dynamic behavior and the discovery of conformer selection by lectins</article-title>
          <source>Acta anatomica</source>
          <year>1998</year>
          <volume>161</volume>
          <fpage>91</fpage>
          <lpage>109</lpage>
          <pub-id pub-id-type="doi">10.1159/000046452</pub-id>
        </citation>
      </ref>
      <ref id="B3-biomolecules-03-00108">
        <label>3.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fadda</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Woods</surname>
              <given-names>R.J.</given-names>
            </name>
          </person-group>
          <article-title>Molecular simulations of carbohydrates and protein-carbohydrate interactions: motivation, issues and prospects</article-title>
          <source>Drug. Discov. Today</source>
          <year>2010</year>
          <volume>15</volume>
          <fpage>596</fpage>
          <lpage>609</lpage>
          <pub-id pub-id-type="doi">10.1016/j.drudis.2010.06.001</pub-id>
        </citation>
      </ref>
      <ref id="B4-biomolecules-03-00108">
        <label>4.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gabius</surname>
              <given-names>H.J.</given-names>
            </name>
            <name>
              <surname>André</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Jiménez-Barbero</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Romero</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Solís</surname>
              <given-names>D.</given-names>
            </name>
          </person-group>
          <article-title>From lectin structure to functional glycomics: principles of sugar code</article-title>
          <source>Trends. Biochem. Sci.</source>
          <year>2011</year>
          <volume>36</volume>
          <fpage>298</fpage>
          <lpage>313</lpage>
          <pub-id pub-id-type="doi">10.1016/j.tibs.2011.01.005</pub-id>
        </citation>
      </ref>
      <ref id="B5-biomolecules-03-00108">
        <label>5.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kamiya</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yagi-Utsumi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Yagi</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Structural and molecular basis of carbohydrate-protein interaction systems as potential therapeutic targets</article-title>
          <source>Curr. Pharm. Des.</source>
          <year>2011</year>
          <volume>17</volume>
          <fpage>1672</fpage>
          <lpage>1684</lpage>
          <pub-id pub-id-type="doi">10.2174/138161211796355074</pub-id>
        </citation>
      </ref>
      <ref id="B6-biomolecules-03-00108">
        <label>6.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lederkremer</surname>
              <given-names>G.Z.</given-names>
            </name>
          </person-group>
          <article-title>Glycoprotein folding, quality control and ER-associated degradation</article-title>
          <source>Curr. Opin. Struct. Biol.</source>
          <year>2009</year>
          <volume>19</volume>
          <fpage>515</fpage>
          <lpage>523</lpage>
          <pub-id pub-id-type="doi">10.1016/j.sbi.2009.06.004</pub-id>
        </citation>
      </ref>
      <ref id="B7-biomolecules-03-00108">
        <label>7.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Aebi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Bernasconi</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Clerc</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Molinari</surname>
              <given-names>M.</given-names>
            </name>
          </person-group>
          <article-title><italic>N</italic>-glycan structures: recognition and processing in the ER</article-title>
          <source>Trends. Biochem. Sci.</source>
          <year>2010</year>
          <volume>35</volume>
          <fpage>74</fpage>
          <lpage>82</lpage>
          <pub-id pub-id-type="doi">10.1016/j.tibs.2009.10.001</pub-id>
        </citation>
      </ref>
      <ref id="B8-biomolecules-03-00108">
        <label>8.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kamiya</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Satoh</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Molecular and structural basis for <italic>N</italic>-glycan-dependent determination of glycoprotein fates in cells</article-title>
          <source>Biochim. Biophys. Acta</source>
          <year>2012</year>
          <volume>1820</volume>
          <fpage>1327</fpage>
          <lpage>1337</lpage>
        <pub-id pub-id-type="doi">10.1016/j.bbagen.2011.12.017</pub-id><pub-id pub-id-type="pmid">22240168</pub-id></citation>
      </ref>
      <ref id="B9-biomolecules-03-00108">
        <label>9.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wormald</surname>
              <given-names>M.R.</given-names>
            </name>
            <name>
              <surname>Petrescu</surname>
              <given-names>A.J.</given-names>
            </name>
            <name>
              <surname>Pao</surname>
              <given-names>Y.L.</given-names>
            </name>
            <name>
              <surname>Glithero</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Elliott</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Dwek</surname>
              <given-names>R.A.</given-names>
            </name>
          </person-group>
          <article-title>Conformational studies of oligosaccharides and glycopeptides: complementarity of NMR, X-ray crystallography, and molecular modelling</article-title>
          <source>Chem. Rev.</source>
          <year>2002</year>
          <volume>102</volume>
          <fpage>371</fpage>
          <lpage>386</lpage>
          <pub-id pub-id-type="doi">10.1021/cr990368i</pub-id>
        </citation>
      </ref>
      <ref id="B10-biomolecules-03-00108">
        <label>10.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Sasakawa</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Kamiya</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Utsumi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Nakano</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Takahashi</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Yamaguchi</surname>
              <given-names>Y.</given-names>
            </name>
          </person-group>
          <article-title>920 MHz ultra-high field NMR approaches to structural glycobiology</article-title>
          <source>Biochim. Biophys. Acta</source>
          <year>2008</year>
          <volume>1780</volume>
          <fpage>619</fpage>
          <lpage>625</lpage>
        <pub-id pub-id-type="doi">10.1016/j.bbagen.2007.11.014</pub-id><pub-id pub-id-type="pmid">18157953</pub-id></citation>
      </ref>
      <ref id="B11-biomolecules-03-00108">
        <label>11.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kamiya</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yamamoto</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Chiba</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Jigami</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Overexpression of a homogeneous oligosaccharide with <sup>13</sup>C labeling by genetically engineered yeast strain</article-title>
          <source>J. Biomol. NMR</source>
          <year>2011</year>
          <volume>50</volume>
          <fpage>397</fpage>
          <lpage>401</lpage>
          <pub-id pub-id-type="doi">10.1007/s10858-011-9525-1</pub-id>
        </citation>
      </ref>
      <ref id="B12-biomolecules-03-00108">
        <label>12.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Herscovics</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Orlean</surname>
              <given-names>P.</given-names>
            </name>
          </person-group>
          <article-title>Glycoprotein biosynthesis in yeast</article-title>
          <source>FASEB J.</source>
          <year>1993</year>
          <volume>7</volume>
          <fpage>540</fpage>
          <lpage>550</lpage>
        <pub-id pub-id-type="pmid">8472892</pub-id></citation>
      </ref>
      <ref id="B13-biomolecules-03-00108">
        <label>13.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nakanishi-Shindo</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Nakayama</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Tanaka</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Toda</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Jigami</surname>
              <given-names>Y.</given-names>
            </name>
          </person-group>
          <article-title>Structure of the <italic>N</italic>-linked oligosaccharides that show the complete loss of a-1,6-polymannose outer chain from <italic>och1</italic>, <italic>och1 mnn1</italic>, and <italic>och1 mnn1 alg3</italic> mutants of <italic>Saccharomyces cerevisiae</italic></article-title>
          <source>J. Biol. Chem.</source>
          <year>1993</year>
          <volume>268</volume>
          <fpage>26338</fpage>
          <lpage>26345</lpage>
        <pub-id pub-id-type="pmid">8253757</pub-id></citation>
      </ref>
      <ref id="B14-biomolecules-03-00108">
        <label>14.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chiba</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Suzuki</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Yoshida</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Yoshida</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Ikenaga</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Takeuchi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Jigami</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Ichishima</surname>
              <given-names>E.</given-names>
            </name>
          </person-group>
          <article-title>Production of human compatible high mannose-type (Man<sub>5</sub>GlcNAc<sub>2</sub>) sugar chains in Saccharomyces cerevisiae</article-title>
          <source>J. Biol. Chem.</source>
          <year>1998</year>
          <volume>273</volume>
          <fpage>26298</fpage>
          <lpage>26304</lpage>
        <pub-id pub-id-type="doi">10.1074/jbc.273.41.26298</pub-id><pub-id pub-id-type="pmid">9756858</pub-id></citation>
      </ref>
      <ref id="B15-biomolecules-03-00108">
        <label>15.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tvaroska</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Taravel</surname>
              <given-names>F.R.</given-names>
            </name>
          </person-group>
          <article-title>One - bond carbon-proton coupling constants: angular dependence in α-linked oligosaccharides</article-title>
          <source>Carbohydr. Res.</source>
          <year>1991</year>
          <volume>221</volume>
          <fpage>83</fpage>
          <lpage>94</lpage>
          <pub-id pub-id-type="doi">10.1016/0008-6215(91)80050-W</pub-id>
        </citation>
      </ref>
      <ref id="B16-biomolecules-03-00108">
        <label>16.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Serianni</surname>
              <given-names>A.S.</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Carmichael</surname>
              <given-names>I.</given-names>
            </name>
          </person-group>
          <article-title>One-bond <sup>13</sup>C-<sup>1</sup>H spin-coupling constants in aldofuranosyl rings: Effect of conformation on coupling magnitude</article-title>
          <source>J. Am. Chem. Soc.</source>
          <year>1995</year>
          <volume>117</volume>
          <fpage>8645</fpage>
          <lpage>8650</lpage>
          <pub-id pub-id-type="doi">10.1021/ja00138a021</pub-id>
        </citation>
      </ref>
      <ref id="B17-biomolecules-03-00108">
        <label>17.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Van Halbeek</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Dorland</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Veldink</surname>
              <given-names>G.A.</given-names>
            </name>
            <name>
              <surname>Vliegenthart</surname>
              <given-names>J.F.G.</given-names>
            </name>
            <name>
              <surname>Strecker</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Michalski</surname>
              <given-names>J.C.</given-names>
            </name>
            <name>
              <surname>Montreuil</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Hull</surname>
              <given-names>W.E.</given-names>
            </name>
          </person-group>
          <article-title>A 500 MHz <sup>1</sup>H NMR study of urinary oligosaccharides from patients with mannosidosis</article-title>
          <source>FEBS Lett.</source>
          <year>1980</year>
          <volume>121</volume>
          <fpage>71</fpage>
          <lpage>77</lpage>
          <pub-id pub-id-type="doi">10.1016/0014-5793(80)81269-5</pub-id>
        </citation>
      </ref>
      <ref id="B18-biomolecules-03-00108">
        <label>18.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vliegenthart</surname>
              <given-names>J.F.G.</given-names>
            </name>
            <name>
              <surname>Dorland</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>van Halbeek</surname>
              <given-names>H.</given-names>
            </name>
          </person-group>
          <article-title>High-resolution, <sup>1</sup>H-nuclear magnetic resonance spectroscopy as a tool in the structural analysis of carbohydrates related to glycoproteins</article-title>
          <source>Adv. Carbohydr. Chem. Biochem.</source>
          <year>1983</year>
          <volume>41</volume>
          <fpage>209</fpage>
          <lpage>374</lpage>
          <pub-id pub-id-type="doi">10.1016/S0065-2318(08)60059-1</pub-id>
        </citation>
      </ref>
      <ref id="B19-biomolecules-03-00108">
        <label>19.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Byrd</surname>
              <given-names>J.C.</given-names>
            </name>
            <name>
              <surname>Tarentino</surname>
              <given-names>A.L.</given-names>
            </name>
            <name>
              <surname>Maley</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Atkinson</surname>
              <given-names>P.H.</given-names>
            </name>
            <name>
              <surname>Trimble</surname>
              <given-names>R.B.</given-names>
            </name>
          </person-group>
          <article-title>Glycoprotein synthesis in yeast. Identification of Man<sub>8</sub>GlcNAc<sub>2</sub> as an essential intermediate in oligosaccharide processing</article-title>
          <source>J. Biol. Chem.</source>
          <year>1982</year>
          <volume>257</volume>
          <fpage>14657</fpage>
          <lpage>14666</lpage>
        <pub-id pub-id-type="pmid">6757247</pub-id></citation>
      </ref>
      <ref id="B20-biomolecules-03-00108">
        <label>20.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>González</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Bruix</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Díaz-Mauriño</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Feizi</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Rico</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Solís</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Jiménez-Barbero</surname>
              <given-names>J.</given-names>
            </name>
          </person-group>
          <article-title>Conformational studies of the Man8 oligosaccharide on native ribonuclease B and on the reduced and denatured protein</article-title>
          <source>Arch. Biochem. Biophys.</source>
          <year>2000</year>
          <volume>383</volume>
          <fpage>17</fpage>
          <lpage>27</lpage>
          <pub-id pub-id-type="doi">10.1006/abbi.2000.2031</pub-id>
        </citation>
      </ref>
      <ref id="B21-biomolecules-03-00108">
        <label>21.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wyss</surname>
              <given-names>D.F.</given-names>
            </name>
            <name>
              <surname>Choi</surname>
              <given-names>J.S.</given-names>
            </name>
            <name>
              <surname>Wagner</surname>
              <given-names>G.</given-names>
            </name>
          </person-group>
          <article-title>Composition and sequence specific resonance assignments of the heterogeneous <italic>N</italic>-linked glycan in the 13.6 kDa adhesion domain of human CD2 as determined by NMR on the intact glycoprotein</article-title>
          <source>Biochemistry</source>
          <year>1995</year>
          <volume>34</volume>
          <fpage>1622</fpage>
          <lpage>1634</lpage>
          <pub-id pub-id-type="doi">10.1021/bi00005a019</pub-id>
        </citation>
      </ref>
      <ref id="B22-biomolecules-03-00108">
        <label>22.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wyss</surname>
              <given-names>D.F.</given-names>
            </name>
            <name>
              <surname>Choi</surname>
              <given-names>J.S.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Knoppers</surname>
              <given-names>M.H.</given-names>
            </name>
            <name>
              <surname>Willis</surname>
              <given-names>K.J.</given-names>
            </name>
            <name>
              <surname>Arulanandam</surname>
              <given-names>A.R.</given-names>
            </name>
            <name>
              <surname>Smolyar</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Reinherz</surname>
              <given-names>E.L.</given-names>
            </name>
            <name>
              <surname>Wagner</surname>
              <given-names>G.</given-names>
            </name>
          </person-group>
          <article-title>Conformation and function of the <italic>N</italic>-linked glycan in the adhesion domain of human CD2</article-title>
          <source>Science</source>
          <year>1995</year>
          <volume>269</volume>
          <fpage>1273</fpage>
          <lpage>1278</lpage>
        <pub-id pub-id-type="doi">10.1126/science.7544493</pub-id><pub-id pub-id-type="pmid">7544493</pub-id></citation>
      </ref>
      <ref id="B23-biomolecules-03-00108">
        <label>23.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Homans</surname>
              <given-names>S.W.</given-names>
            </name>
            <name>
              <surname>Pastore</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Dwek</surname>
              <given-names>R.A.</given-names>
            </name>
            <name>
              <surname>Rademacher</surname>
              <given-names>T.W.</given-names>
            </name>
          </person-group>
          <article-title>Structure and dynamics in oligomannose-type oligosaccharides</article-title>
          <source>Biochemistry</source>
          <year>1987</year>
          <volume>26</volume>
          <fpage>6649</fpage>
          <lpage>6655</lpage>
          <pub-id pub-id-type="doi">10.1021/bi00395a014</pub-id>
        </citation>
      </ref>
      <ref id="B24-biomolecules-03-00108">
        <label>24.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wooten</surname>
              <given-names>E.W.</given-names>
            </name>
            <name>
              <surname>Bazzo</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Edge</surname>
              <given-names>C.J.</given-names>
            </name>
            <name>
              <surname>Zamze</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Dwek</surname>
              <given-names>R.A.</given-names>
            </name>
            <name>
              <surname>Rademacher</surname>
              <given-names>T.W.</given-names>
            </name>
          </person-group>
          <article-title>Primary sequence dependence of conformation in oligomannose oligosaccharides</article-title>
          <source>Eur. Biophys. J.</source>
          <year>1990</year>
          <volume>18</volume>
          <fpage>139</fpage>
          <lpage>148</lpage>
          <pub-id pub-id-type="doi">10.1007/BF02427373</pub-id>
        </citation>
      </ref>
      <ref id="B25-biomolecules-03-00108">
        <label>25.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Woods</surname>
              <given-names>R.J.</given-names>
            </name>
            <name>
              <surname>Pathiaseril</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Wormald</surname>
              <given-names>M.R.</given-names>
            </name>
            <name>
              <surname>Edge</surname>
              <given-names>C.J.</given-names>
            </name>
            <name>
              <surname>Dwek</surname>
              <given-names>R.A.</given-names>
            </name>
          </person-group>
          <article-title>The high degree of internal flexibility observed for an oligomannose oligosaccharide does not alter the overall topology of the molecule</article-title>
          <source>Eur. J. Biochem.</source>
          <year>1998</year>
          <volume>258</volume>
          <fpage>372</fpage>
          <lpage>386</lpage>
        <pub-id pub-id-type="doi">10.1046/j.1432-1327.1998.2580372.x</pub-id><pub-id pub-id-type="pmid">9874202</pub-id></citation>
      </ref>
      <ref id="B26-biomolecules-03-00108">
        <label>26.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Balaji</surname>
              <given-names>P.V.</given-names>
            </name>
            <name>
              <surname>Qasba</surname>
              <given-names>P.K.</given-names>
            </name>
            <name>
              <surname>Rao</surname>
              <given-names>V.S.</given-names>
            </name>
          </person-group>
          <article-title>Molecular dynamics simulations of high-mannose oligosaccharides</article-title>
          <source>Glycobiology</source>
          <year>1994</year>
          <volume>4</volume>
          <fpage>497</fpage>
          <lpage>515</lpage>
          <pub-id pub-id-type="doi">10.1093/glycob/4.4.497</pub-id>
        </citation>
      </ref>
      <ref id="B27-biomolecules-03-00108">
        <label>27.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Abe</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Takaoka</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Chiba</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Sato</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Ohgiya</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Itadani</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Hirashima</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Shimoda</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Jigami</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Nakayama</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Development of valuable yeast strains using a novel mutagenesis technique for the effective production of therapeutic glycoproteins</article-title>
          <source>Glycobiology</source>
          <year>2009</year>
          <volume>19</volume>
          <fpage>428</fpage>
          <lpage>436</lpage>
        <pub-id pub-id-type="pmid">19129247</pub-id></citation>
      </ref>
      <ref id="B28-biomolecules-03-00108">
        <label>28.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Longtine</surname>
              <given-names>M.S.</given-names>
            </name>
            <name>
              <surname>McKenzie</surname>
              <given-names>A.</given-names>
              <suffix>3rd</suffix>
            </name>
            <name>
              <surname>Demarini</surname>
              <given-names>D.J.</given-names>
            </name>
            <name>
              <surname>Shah</surname>
              <given-names>N.G.</given-names>
            </name>
            <name>
              <surname>Wach</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Brachat</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Philippsen</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Pringle</surname>
              <given-names>J.R.</given-names>
            </name>
          </person-group>
          <article-title>Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae</article-title>
          <source>Yeast</source>
          <year>1998</year>
          <volume>14</volume>
          <fpage>953</fpage>
          <lpage>961</lpage>
          <pub-id pub-id-type="doi">10.1002/(SICI)1097-0061(199807)14:10&lt;953::AID-YEA293&gt;3.0.CO;2-U</pub-id>
        </citation>
      </ref>
      <ref id="B29-biomolecules-03-00108">
        <label>29.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gietz</surname>
              <given-names>R.D.</given-names>
            </name>
            <name>
              <surname>Schiestl</surname>
              <given-names>R.H.</given-names>
            </name>
          </person-group>
          <article-title>High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method</article-title>
          <source>Nat. Protoc.</source>
          <year>2007</year>
          <volume>2</volume>
          <fpage>31</fpage>
          <lpage>34</lpage>
          <pub-id pub-id-type="doi">10.1038/nprot.2007.13</pub-id>
        </citation>
      </ref>
      <ref id="B30-biomolecules-03-00108">
        <label>30.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Peat</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Whelan</surname>
              <given-names>W.J.</given-names>
            </name>
            <name>
              <surname>Edwards</surname>
              <given-names>T.E.</given-names>
            </name>
          </person-group>
          <article-title>Polysaccharides of Baker's Yeast. Part IV. Mannan</article-title>
          <source>J. Chem Soc.</source>
          <year>1961</year>
          <fpage>29</fpage>
          <lpage>34</lpage>
        </citation>
      </ref>
      <ref id="B31-biomolecules-03-00108">
        <label>31.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tanabe</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Ikenaka</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>In-column removal of hydrazine and <italic>N</italic>-acetylation of oligosaccharides released by hydrazionolysis</article-title>
          <source>Anal. Biochem.</source>
          <year>2006</year>
          <volume>348</volume>
          <fpage>324</fpage>
          <lpage>326</lpage>
          <pub-id pub-id-type="doi">10.1016/j.ab.2005.10.035</pub-id>
        </citation>
      </ref>
      <ref id="B32-biomolecules-03-00108">
        <label>32.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Takahashi</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>GALAXY (Glycoanalysis by the Three Axes of MS and Chromatography): a web application that assists structural analyses of <italic>N</italic>-glycans</article-title>
          <source>Trends. Glycosci. Glycotech.</source>
          <year>2003</year>
          <volume>14</volume>
          <fpage>235</fpage>
          <lpage>251</lpage>
          <pub-id pub-id-type="doi">10.4052/tigg.15.235</pub-id>
        </citation>
      </ref>
      <ref id="B33-biomolecules-03-00108">
        <label>33.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kamiya</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yamaguchi</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Takahashi</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Arata</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Kasai</surname>
              <given-names>K.I.</given-names>
            </name>
            <name>
              <surname>Ihara</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Matsuo</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Ito</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yamamoto</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Sugar-binding properties of VIP36, an intracellular animal lectin operating as a cargo receptor</article-title>
          <source>J. Biol. Chem.</source>
          <year>2005</year>
          <volume>280</volume>
          <fpage>37178</fpage>
          <lpage>37182</lpage>
        <pub-id pub-id-type="doi">10.1074/jbc.M505757200</pub-id><pub-id pub-id-type="pmid">16129679</pub-id></citation>
      </ref>
      <ref id="B34-biomolecules-03-00108">
        <label>34.</label>
        <citation citation-type="book">
          <person-group person-group-type="author">
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Takahashi</surname>
              <given-names>N.</given-names>
            </name>
          </person-group>
          <article-title>GALAXY database and pyridilaminated oligosaccharide library</article-title>
          <source>Experimental Glycoscience: Glycobiology</source>
          <person-group person-group-type="editor">
            <name>
              <surname>Taniguchi</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Suzuki</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Narimatsu</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Kawasaki</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Hase</surname>
              <given-names>S.</given-names>
            </name>
          </person-group>
          <publisher-name>Springer</publisher-name>
          <publisher-loc>The Netherlands</publisher-loc>
          <year>2008</year>
          <fpage>413</fpage>
          <lpage>416</lpage>
        </citation>
      </ref>
      <ref id="B35-biomolecules-03-00108">
        <label>35.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kamiya</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Kamiya</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Yamamoto</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Nyfeler</surname>
              <given-names>B.</given-names>
            </name>
            <name>
              <surname>Hauri</surname>
              <given-names>H.P.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Molecular basis of sugar recognition by the human L-type lectins ERGIC-53, VIPL, and VIP36</article-title>
          <source>J. Biol. Chem.</source>
          <year>2008</year>
          <volume>283</volume>
          <fpage>1857</fpage>
          <lpage>1861</lpage>
        <pub-id pub-id-type="pmid">18025080</pub-id></citation>
      </ref>
      <ref id="B36-biomolecules-03-00108">
        <label>36.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Delaglio</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Grzesiek</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Vuister</surname>
              <given-names>G.W.</given-names>
            </name>
            <name>
              <surname>Zhu</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Pfeifer</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Bax</surname>
              <given-names>A.</given-names>
            </name>
          </person-group>
          <article-title>NMRPipe: a multidimensional spectral processing system based on UNIX pipes</article-title>
          <source>J. Biomol. NMR</source>
          <year>1995</year>
          <volume>6</volume>
          <fpage>277</fpage>
          <lpage>293</lpage>
        <pub-id pub-id-type="pmid">8520220</pub-id></citation>
      </ref>
      <ref id="B37-biomolecules-03-00108">
        <label>37.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yamamoto</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yamaguchi</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Kameda</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Lanthanide-assisted NMR evaluation of a dynamic ensemble of oligosaccharide conformations</article-title>
          <source>Chem. Commun.</source>
          <year>2012</year>
          <volume>48</volume>
          <fpage>4752</fpage>
          <lpage>4754</lpage>
          <pub-id pub-id-type="doi">10.1039/c2cc30353a</pub-id>
        </citation>
      </ref>
      <ref id="B38-biomolecules-03-00108">
        <label>38.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Yamamoto</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Yamaguchi</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>K.</given-names>
            </name>
          </person-group>
          <article-title>Application of Paramagnetic NMR-Validated Molecular Dynamics Simulation to the Analysis of a Conformational Ensemble of a Branched Oligosaccharide</article-title>
          <source>Molecules</source>
          <year>2012</year>
          <volume>17</volume>
          <fpage>6658</fpage>
          <lpage>6671</lpage>
          <pub-id pub-id-type="doi">10.3390/molecules17066658</pub-id>
        </citation>
      </ref>
      <ref id="B39-biomolecules-03-00108">
        <label>39.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Demarco</surname>
              <given-names>M.L.</given-names>
            </name>
            <name>
              <surname>Woods</surname>
              <given-names>R.J.</given-names>
            </name>
            <name>
              <surname>Prestegard</surname>
              <given-names>J.H.</given-names>
            </name>
            <name>
              <surname>Tian</surname>
              <given-names>F.</given-names>
            </name>
          </person-group>
          <article-title>Presentation of membrane-anchored glycosphingolipids determined from molecular dynamics simulations and NMR paramagnetic relaxation rate enhancement</article-title>
          <source>J. Am. Chem. Soc.</source>
          <year>2010</year>
          <volume>132</volume>
          <fpage>1334</fpage>
          <lpage>1338</lpage>
          <pub-id pub-id-type="doi">10.1021/ja907518x</pub-id>
        </citation>
      </ref>
      <ref id="B40-biomolecules-03-00108">
        <label>40.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Erdélyi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>d'Auvergne</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Navarro-Vázquez</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Leonov</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Griesinger</surname>
              <given-names>C.</given-names>
            </name>
          </person-group>
          <article-title>Dynamics of the glycosidic bond: conformational space of lactose</article-title>
          <source>Chemistry</source>
          <year>2011</year>
          <volume>17</volume>
          <fpage>9368</fpage>
          <lpage>9376</lpage>
          <pub-id pub-id-type="doi">10.1002/chem.201100854</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>
