Samples were collected from seven patients affected with typical HGPS, HGPS-like or MAD-B syndromes, showing variable clinical phenotypes and disease severity but having in common the accumulation of aberrant Prelamin A isoforms. Patients were from France (HGPS-L5), Greece (HGPS-L3), UK (HGPS-L2 and HGPS-L4), USA (HGPS-L1) and Togo (MAD-B). Informed consents were obtained from the patients or the parents of minor patients included in this work, allowing studies on their cells as part of a diagnostic and research program, complying with the ethical guidelines of the institutions involved. Parents also gave written consent for picture publication. The dermal fibroblast cell line from patient HGPS-L 1 was provided by the Progeria Research Foundation Cell and Tissue Bank under the cell line name PSADFN386 (www.progeriaresearch.org); the other human dermal fibroblast cell lines were issued from a skin biopsy, prepared and stored by the labeled Biological Resource Center (CRB TAC), Department of Medical Genetics, Timone Hospital of Marseille (A. Robaglia-Schlupp and K. Bertaux) according to the French regulation. The fibroblast cell lines used belong to a biological sample collection declared to the French ministry of Health (declaration number DC-2008-429) whose use for research purposes was authorized by the French ministry of Health (authorization number AC-2011-1312). The fibroblasts cell lines were cultured in Dulbecco’s modified Eagle’s medium (Life Technologies, Waltham, MA, USA) supplemented with 15% fetal bovine serum (Life Technologies), 2 mm l-glutamine (Life Technologies) and 100 U/mL of penicillin, streptomycin and amphotericin B mix (Life Technologies) at 37 °C in a humidified atmosphere containing 5% CO₂.

For morpholino delivery, we used the Endoporter system and followed the manufacturer’s instructions (Gene Tools, LLC, Philomath, OR, USA). Briefly, cells were plated at 50% subconfluence in DMEM (Life Technologies) containing 10% fetal bovine serum (Life Technologies) and 2 mm l-glutamine (Life Technologies) at 37 °C in a humidified atmosphere of 5% CO₂. Each morpholino oligonucleotide was added at a final concentration of 20 µM to cell cultures in six-well plates. Endoporter reagent was added at a final concentration of 6 µM. Cells were retransfected 48 h later. The effect of morpholino oligonucleotides was assayed 96 h after the first transfection. All transfection experiments were repeated three times.

Combinations of morpholino oligonucleotides sequences were personalized for each patient’s LMNA genotype as described in Table 1. Indeed, as previously mentioned, Lamins A/C are generated by alternative splicing of the LMNA gene. The use of a donor splice site within exon 10, generates the Prelamin A-encoding transcripts. A common SNP (dbSNP rs4641: C > T) is located at this alternative splice site [33,34,35], at position c.1698 of the Prelamin A-encoding transcript (NM_170707.3) and was contained in the Ex10 morpholino target sequence (indicated in bold in Table 1). The rs4641 allele segregating in cis on the mutated chromosomes of HGPS-like patients was determined from each patient’s cell line by Sanger sequencing of aberrant Prelamin A transcripts, amplified by RT-PCRs spanning exons 10 and 11, in order to be able to design for each patient the most efficient Ex10 morpholino AON targeting the mutated pre-mRNAs. For the MAD-B patient, for whom rs4641 was homozygous “C” at the genomic level, only the morpholino directed against exon 10 and targeting all the Prelamin A transcripts was used (Table 1). For HGPS-L4 a specific morpholino directed against Prelamin A Δ35 was designed and used in combination with Morpholino-Ex10.

Total RNAs were isolated from cultured cells using RNeasy plus extraction kit (Qiagen, Valencia, CA, USA) and the samples were quantified and evaluated for purity (260 nm/280 nm ratio) with a NanoDrop ND-1000 spectrophotometer. Five hundred nanograms of RNA was reverse transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA), using random hexamers. PCR amplifications were performed with 2 µL of RT-product with specific primers using the following program: a denaturation step at 95 °C for 3 min, followed by 30 cycles including 95 °C for 30 s, 60 °C for 30 s and finally 72 °C for 45 s and a final elongation step of 3 min. PCR products were separated by electrophoresis in a 2% agarose gel containing ethidium bromide. Primers used for Lamin transcripts amplification were located in exons 9 and 12: forward (5′-GTGGAAGGCACAGAACACCT-3′) and reverse (5′-GTGAGGAGGACGCAGGAA-3′). To analyze the effect of antisense oligonucleotides on β-actin and GAPDH the following primers were used: β-actin ex4-ex5F: 5′-CGCGAGCACAGAGCCTCG-3′; β-actin ex4-ex5R: 5′-TCTTCTCGCGGTTGGCCTTG-3′; β-actin ex3-ex4F: 5′-ACCCAGATCATGTTTGAGAC-3′; β-actin ex3-ex4R: 5′-GGCAGTGATCTCCTTCTGC-3′; β-actin ex1-ex3F: 5′-CCAGCACAATGAAGATCAAGATC-3′; β-actin ex1-ex3R: 5′-TTCAACTGGTCTCAAGTCAGTG-3′; GAPDH ex7-ex9F: 5′-TCCTCCTGTTCGACAGTCAG-3′; GAPDH ex7-ex9R: 5′-AGTTGGTGGTGCAGGAGGC-3′; GAPDH ex1-ex7F: 5′-CCTGGCCAAGGTCATCCATG-3′; GAPDH ex1-ex7R: 5′-GTACTTTATTGATGGTACATGAC-3′.

Quantitative RT-PCR (qRT-PCR) was carried out with the TaqMan Gene Expression Master Mix on a LightCycler 480 (Roche, Berlin, Germany) using pre-designed primers for GAPDH (Hs00266705_g1), Progerin (F: ACTGCAGCAGCTCGGGG. R: TCTGGGGGCTCTGGGC and probe: CGCTGAGTACAACCT), Lamin A (F: TCTTCTGCCTCCAGTGTCACG. R: AGTTCTGGGGGCTCTGGGT and probe: ACTCGCAGCTACCG), Lamin C (F: CAACTCCACTGGGGAAGAAGTG. R: CGGCGGCTACCACTCAC and probe: ATGCGCAAGCTGGTG), Prelamin A Δ90 (F: CGAGGATGAGGATGGAGATGA. R: CAGGTCCCAGATTACATGATGCT, overlapping exons 10 and 12 and probe: CACCACAGCCCCCAGA) (Applied Biosystems) using the program: UNG incubation at 50 °C for 2 min, initial denaturation at 95 °C for 10 min, 45 cycles of amplification: denaturation at 95 °C for 15 s and annealing at 60 °C for 1 min. All PCR reactions were performed in triplicate. Threshold cycle (Ct) values were used to calculate relative mRNA expression by the 2-ΔΔCT relative quantification method using normalization to GAPDH expression and EP condition as the reference value for each patient.

Total fibroblast proteins were extracted in 200 μL of NP40 Cell Lysis buffer (Invitrogen, Carlsbad, CA, USA) containing Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific Inc. Waltham, MA, USA). Cells were sonicated twice (30 s each), incubated at 4 °C for 30 min and then centrifuged at 10,000 g for 10 min. Protein concentration was evaluated with the bicinchoninic acid technique (Pierce BCA Protein Assay Kit), absorbance at 562 nm is measured using nanodrop 1000 (Thermo Fisher Scientific Inc. Waltham, MA, USA) Equal amounts of proteins (40 µg) were loaded onto 10% Tis-Glycine gel (CriterionTM XT precast gel) using XT Tricine running Buffer (Biorad, Hercules, CA, USA). After electrophoresis, gels were electro transferred onto nitrocellulose membranes or Immobilon-FL polyvinylidene fluoride membranes (Millipore), blocked in Odyssey Blocking Buffer diluted 1:1 in PBS for 1 h at room temperature, and incubated overnight at 4 °C or 2 h at room temperature with various primary antibodies diluted in blocking buffer added with 0.1% Tween 20: 1:1000 rabbit polyclonal anti-Lamin A/C (sc-20681, Santa Cruz Biotechnology, Dallas, TX, USA), 1:200 goat polyclonal anti-Lamin A/C (sc-6215, Santa Cruz Biotechnology), 1:1000 mouse monoclonal anti-Progerin (ab66587, Abcam, Cambridge, UK), 1:1000 mouse monoclonal anti-actin (MAB1501, Merck Millipore, Darmstadt, Germany) and 1:40,000 monoclonal anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (MAB374, Merck Millipore). Blots were washed with TBS-T buffer [20 mM tris (pH 7.4), 150 mm NaCl, and 0.05% Tween 20] and incubated with 1:10,000 IR-Dye 800-conjugated secondary donkey anti-goat or IR-Dye 700-conjugated secondary anti-mouse antibodies (LI-COR Biosciences) in blocking buffer added with 0.1% Tween 20 (LI-COR Biosciences, Lincoln, NE, USA). For IR-Dye 800 and IR-Dye 700 detection, an Odyssey Infrared Imaging System (LI-COR Biosciences) was used. GAPDH, α-tubulin or β-actin were used as a total cellular protein loading control.

Senescence was measured with a Beta-Glo Assay kit (Promega), according to the manufacturer’s instructions. Luminescence intensity was determined as relative light units (RLUs) using a GloMax-Multi Detection System: Luminometer (Promega, Madison, WI, USA).

Fibroblasts from HGPS and HGPS-like patients were cultured with DMEM medium containing 20 µM AON, or 6 µM of vehicle (Endoporter) for 96 h. Cells stained for Lamin A/C or DAPI were examined by fluorescence microscopy with an Axioplan 2 imaging microscope (Carl Zeiss, Oberkochen, Germany). For quantitation of abnormal nuclear morphology, the percentage of normal nuclei (nuclei with a smooth oval shape) and abnormal nuclei (nuclei with blebs, irregular shape, or multiple folds) was calculated using the Nuclear Irregularity Index (NII) plugin of the Image J Software (Version 1.6.0, NIH, USA). The analysis uses measures of nuclear area and of four parameters of irregularity, named Aspect, Area/Box, Radius Ratio and Roundness. These four parameters are used to generate a Nuclear Irregularity Index (NII) which, added to area measurement, classify the nuclei in normal or abnormal morphology. At least 100 fibroblast nuclei were randomly selected for each cell line.

Statistical analyses were performed with GraphPad Prism 6 (GraphPad Software, Inc. San Diego, CA, USA). Differences between groups were assayed using a two-tailed Student’s t-test. In all cases the experimental data were assumed to fulfill t-test requirements (normal distribution and similar variance); in those cases, where the assumption of the t-test was not valid, a non-parametric statistical method was used (Mann–Whitney test). A p value less than 0.05 was considered as significant. Error bars indicate the standard error of the mean.

Patients included in this study showed variable disease severity compared to classical HGPS but presented with similar phenotypes, including poor growth, hair loss, prominent forehead, prominent superficial veins, thin skin, loss of subcutaneous fat and lipodystrophy (Figure 1A). HGPS-like patients were previously reported to present distinct aberrant splicing patterns of Prelamin A pre-mRNAs due to mutations located around exon 11 donor splice site (Figure 1B,C). Patient HGPS-L1 carrying the LMNA heterozygous c.1968 + 2T > C mutation was referred to our center at age five years old. She was diagnosed with the disease when she was 10 months old, presenting with a typical HGPS clinical phenotype, including frontal bossing, prominent veins on her scalp and forehead, sparse hair, micrognathism with delayed dentition, growth retardation (since birth, her length varied from the 2nd to the 10th centiles for age; the weight was stably <3rd centile for age), subcutaneous lipoatrophy, dry skin with pigmentary changes on the neck and trunk, acroosteolyses with onychodystrophy of hands and feet; laboratory findings have evidenced recurrent thrombocytosis (480–535 k/µL; normal values: 140–450 k/µL), elevated transaminases, glucose, calcium and phosphorus, as already observed in classical HGPS patients [36]. HGPS-L2 patient, carrying the heterozygous LMNA c.1968 + 1G > A mutation, showed a very similar progeroid laminopathy, though evolving more severely. She was diagnosed at nine months of age and already showed contractions of her ankles, knees, and wrist. She subsequently developed arthritis on several articulations. Her feeding was poor and she had frequent constipation episodes. She had bilateral hip dislocation and at the age of three years she suffered from a femur fracture. At age six, she suffered from tachycardia together with sudden right arm paresis; cerebral CT scan/MRI showed multiple micro-infarcts, including recent and old ones, while echocardiography showed left ventricular thickening. After partial recovery from stroke, she suffered from a chest infection together with painful nails’ infections. Patients HGPS-L3 (LMNA heterozygous c.1968 + 5G > C), HGPS-L4 (LMNA heterozygous c.1868C > G) and HGPS-L5 (LMNA heterozygous c.1968G > A) were previously reported by Barthelemy et al. [12]. The MAD-B patient was first referred to us at age 6.5 years. She presented with growth retardation, exophtalmia, low-set ears, retro-micrognathism (mandibular hypoplasia), sparse hair and thin, dry skin with hypopigmented lesions, especially on the trunk. Subcutaneous lipoatrophy gave her a muscular pseudo-hypertrophic appearance. Molecular genetic diagnosis allowed the identification of a new homozygous mutation in the ZMPSTE24/FACE1 gene’s exon 10: c.1274T > C, p.(Leu425Pro), confirming the B-type Mandibuloacral dysplasia phenotype in the patient [19].

To evaluate the effects of antisense morpholinos in reducing aberrant LMNA splicing, we treated the primary fibroblasts cell lines of five patients with HGP-like syndromes, one patient with HGPS and one patient with MAD-B, following the same protocol described in [25] and adapted depending on the splice donor site and the genotype of the patient at dbSNP rs4641.

As shown in Figure 2A, the effect of antisense morpholinos was first assessed at the transcriptional level by semi-quantitative RT-PCR using primers flanking the region between exons 9 and 12 of the LMNA gene (cf. Section 2.4) and generating amplicons that were, respectively, 510 bp (Lamin A), 405 bp (Prelamin A Δ35) and 360 bp (Prelamin A Δ50). The results show that treatment of cells either with scrambled AON or with Endoporter had no effect on the levels of aberrant Prelamin A transcripts, which were similar to non-treated (NT) samples and did not result in generation of any aberrant splice products for β-actin and GAPDH suggesting that the observed response was specific to the personalized morpholino AON. For the cell lines of patients HGPS-L2 and -L3, the exploration was not entirely replicated since the AON used were exactly the same as for patient HGPS-L1, in whom no aberrant splicing was evidenced (cf. Table 1). When compared to control cells treated with Endoporter (EP), the analysis of aberrant transcripts’ amounts upon morpholino treatment revealed clear reductions in Lamin A and Prelamin A Δ50 mRNA in HGPS, HGPS-L1, HGPS-L2, HGPS-L3 and HGPS-L5 patients’ cells and Prelamin A Δ35 mRNA in HGPS-L4 patient cells. We obtained similar results when we analyzed the amounts of these aberrant isoforms, including Prelamin A Δ90, in morpholino-treated cells using quantitative RT-PCR (Figure 2B). Indeed, deleted Prelamin A transcripts were greatly reduced, and the one corresponding to Lamin C was increased, as expected, due to the directed splicing shift of LMNA pre-mRNAs, favoring Lamin C production at the expense of Lamin A isoforms. The treatment also significantly decreased the production of Lamin A transcripts in MAD-B fibroblasts.

The significant reduction of aberrant Prelamin A mRNA levels prompted us to evaluate the corresponding protein levels upon morpholino AON treatment. As shown in Figure 3, we observed that treatment of patients’ fibroblasts with morpholinos led to a marked decrease of all aberrant Prelamin A protein levels relative to Endoporter treated cells (control) in all patients, including the MAD-B patient.

Moreover, given the heterozygous status of the LMNA rs4641 allele in the HGPS patient, carrying the rs4641 “C” genotype in cis of the c.1824C > T mutation, we showed that the use of morpholino-Ex10 “C allele” was about 25% more effective in reducing Progerin levels than the Ex10-morpholino “T allele”. Similarly, we have shown that treatments with scrambled AON as well as with the Endoporter had no effect on Prelamin A levels, indicating the specific action of the personalized morpholino AON in reducing Prelamin A isoforms’ expression.

Finally, since cellular senescence is considered as a major hallmark of HGPS, we assessed senescence levels, measured by β-galactosidase quantification, upon morpholino AON treatment in HGPS, HGPS-like and MAD-B fibroblasts. As shown in Figure 4A, in all the tested cell lines, senescence-associated β-galactosidase activity levels were decreased by a 10-day-long morpholino treatment, when compared to the same cell lines treated the same number of days with Endoporter. In addition, Using Lamin A/C and DAPI staining, the characteristic nuclear defects have been explored to determine the effectiveness of AON treatments towards reversing HGPS and HGPS-like nuclear abnormalities. As shown in Figure 4B, among the cells tested, HGPS, HGPS-L3 and HGPS-L4 exhibited a significant reduction in nuclear blebbing compared with the passage-matched and Endoporter-treated cells.