<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v2.3 20070202//EN" "journalpublishing.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" xml:lang="en" article-type="research-article">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">toxins</journal-id>
      <journal-title>Toxins</journal-title>
      <abbrev-journal-title abbrev-type="publisher">Toxins</abbrev-journal-title>
      <abbrev-journal-title abbrev-type="pubmed">Toxins</abbrev-journal-title>
      <issn pub-type="epub">2072-6651</issn>
      <publisher>
        <publisher-name>MDPI</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.3390/toxins4090695</article-id>
      <article-id pub-id-type="publisher-id">toxins-04-00695</article-id>
      <article-categories>
        <subj-group>
          <subject>Article</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title><italic>Aspergillus</italic> Oxylipin Signaling and Quorum Sensing Pathways Depend on G Protein-Coupled Receptors </article-title>
      </title-group>
	  <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Affeldt</surname>
            <given-names>Katharyn J.</given-names>
          </name>
          <xref rid="af1-toxins-04-00695" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Brodhagen</surname>
            <given-names>Marion</given-names>
          </name>
          <xref rid="af2-toxins-04-00695" ref-type="aff">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Keller</surname>
            <given-names>Nancy P.</given-names>
          </name>
          <xref rid="af1-toxins-04-00695" ref-type="aff">1</xref>
          <xref rid="c1-toxins-04-00695" ref-type="corresp">*</xref>
        </contrib>
      </contrib-group>
      
      <aff id="af1-toxins-04-00695"><label>1 </label>Department of Bacteriology and Department of Medical Microbiology and Immunology, 1550 Linden Drive, Madison, WI 53706, USA; Email: <email>kjschmitt2@wisc.edu</email></aff>
      <aff id="af2-toxins-04-00695"><label>2 </label>Department of Biology, Western Washington University, 516 High Street, Bellingham, WA 98225, USA; Email: <email>Marion.Brodhagen@wwu.edu</email></aff>
      <author-notes>
        <corresp id="c1-toxins-04-00695"><label>*</label> Author to whom correspondence should be addressed; Email: <email>npkeller@wisc.edu</email>; Tel.: +1-608-262-9795; Fax: +1-608-262-8418.</corresp>
      </author-notes>
      <pub-date pub-type="epub">
        <day>18</day>
        <month>09</month>
        <year>2012</year>
      </pub-date>
      <pub-date pub-type="collection">
	  <month>09</month>
        <year>2012</year>
      </pub-date>
      <volume>4</volume>
      <issue>9</issue>
      <fpage>695</fpage>
      <lpage>717</lpage>
      <history>
        <date date-type="received">
          <day>03</day>
          <month>08</month>
          <year>2012</year>
        </date>
        <date date-type="rev-recd">
          <day>31</day>
          <month>08</month>
          <year>2012</year>
        </date>
        <date date-type="accepted">
          <day>31</day>
          <month>08</month>
          <year>2012</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>©  2012 by the authors; licensee MDPI, Basel, Switzerland.</copyright-statement>
        <copyright-year>2012</copyright-year>
        <license xmlns:xlink="http://www.w3.org/1999/xlink" license-type="open-access" xlink:href="http://creativecommons.org/licenses/by/3.0/">
          <p>This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (<uri>http://creativecommons.org/licenses/by/3.0/</uri>).</p>
        </license>
      </permissions>
      <abstract>
        <p>Oxylipins regulate <italic>Aspergillus</italic> development and mycotoxin production and are also involved in <italic>Aspergillus</italic> quorum sensing mechanisms. Despite extensive knowledge of how these oxylipins are synthesized and what processes they regulate, nothing is known about how these signals are detected and transmitted by the fungus. G protein-coupled receptors (GPCR) have been speculated to be involved as they are known oxylipin receptors in mammals, and many putative GPCRs have been identified in the Aspergilli. Here, we present evidence that oxylipins stimulate a burst in cAMP in <italic>A. nidulans</italic>, and that loss of an <italic>A. nidulans</italic> GPCR, <italic>gprD</italic>, prevents this cAMP accumulation. <italic>A. flavus</italic> undergoes an oxylipin-mediated developmental shift when grown at different densities, and this regulates spore, sclerotial and aflatoxin production. <italic>A. flavus</italic> encodes two putative GprD homologs, GprC and GprD, and we demonstrate here that they are required to transition to a high-density development state, as well as to respond to spent medium of a high-density culture. The finding of GPCRs that regulate production of survival structures (sclerotia), inoculum (spores) and aflatoxin holds promise for future development of anti-fungal therapeutics. </p>
      </abstract>
      <kwd-group>
        <kwd>aflatoxin</kwd>
        <kwd>
          <italic>Aspergillus</italic>
        </kwd>
        <kwd>oxylipin</kwd>
        <kwd>G protein-coupled receptor (GPCR)</kwd>
        <kwd>quorum sensing</kwd>
        <kwd>sclerotia </kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec sec-type="intro">
      <title>1. Introduction</title>
      <p><italic>Aspergillus flavus</italic> is a soil-borne pathogen that infects a variety of food and feed crops including maize, peanuts, cottonseed, and tree nuts, both pre- and post-harvest. <italic>A. flavus</italic> produces aflatoxin (AF), the most potent natural carcinogen known [<xref ref-type="bibr" rid="B1-toxins-04-00695">1</xref>], which causes fatal aflatoxicosis at high doses. At low doses, AF is still very dangerous as it causes a critical mutation in the tumor suppressor protein p53, leading to hepatocellular carcinoma, or liver cancer [<xref ref-type="bibr" rid="B2-toxins-04-00695">2</xref>,<xref ref-type="bibr" rid="B3-toxins-04-00695">3</xref>]. Beyond the health implications, <italic>A. flavus</italic> outbreaks occur across the globe, causing devastating losses to local food supplies and local economies in the billion-dollar range worldwide [<xref ref-type="bibr" rid="B4-toxins-04-00695">4</xref>,<xref ref-type="bibr" rid="B5-toxins-04-00695">5</xref>]. To develop effective means of combatting this pathogen, a deeper understanding is needed of the basic developmental pathways that lead to AF biosynthesis and the persistence of the fungus through asexual spores and recalcitrant overwintering structures, called sclerotia. Spores are the initial inoculum of the fungus, and sclerotia allow the fungus to survive in the soil over harsh environments, such as drought and cold temperatures.</p>
      <p>One of the primary signals for <italic>Aspergillus</italic> spore and sclerotia development are oxylipins (oxygenated polyunsaturated fatty acids), which act as autocrine and paracrine mediators in eukaryotic organisms [<xref ref-type="bibr" rid="B6-toxins-04-00695">6</xref>]. In addition to their endogenous functions, oxylipins can also engage in inter-organismal signaling across multiple phyla [<xref ref-type="bibr" rid="B7-toxins-04-00695">7</xref>,<xref ref-type="bibr" rid="B8-toxins-04-00695">8</xref>,<xref ref-type="bibr" rid="B9-toxins-04-00695">9</xref>] including <italic>Aspergillus</italic>/seed cross-talk [<xref ref-type="bibr" rid="B10-toxins-04-00695">10</xref>,<xref ref-type="bibr" rid="B11-toxins-04-00695">11</xref>,<xref ref-type="bibr" rid="B12-toxins-04-00695">12</xref>,<xref ref-type="bibr" rid="B13-toxins-04-00695">13</xref>]. Oxylipins are made by oxygenase enzymes, found throughout the tree of life, that incorporate oxygen into a fatty acid backbone. Study of these enzymes in the Aspergilli and other fungi has revealed their importance in fungal development and mycotoxin production [<xref ref-type="bibr" rid="B14-toxins-04-00695">14</xref>,<xref ref-type="bibr" rid="B15-toxins-04-00695">15</xref>,<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>,<xref ref-type="bibr" rid="B17-toxins-04-00695">17</xref>,<xref ref-type="bibr" rid="B18-toxins-04-00695">18</xref>]. </p>
      <p><italic>Aspergillus nidulans</italic> is often used as a model organism to elucidate developmental processes in other filamentous fungi, including <italic>A. flavus.</italic> In <italic>A. nidulans,</italic> three dioxygenase enzymes (PpoA, PpoB, and PpoC) contribute to oxylipin production [<xref ref-type="bibr" rid="B19-toxins-04-00695">19</xref>,<xref ref-type="bibr" rid="B20-toxins-04-00695">20</xref>,<xref ref-type="bibr" rid="B21-toxins-04-00695">21</xref>]. Deletion of <italic>ppo</italic> genes affects the gene transcription and production of at least two secondary metabolites in <italic>A. nidulans</italic>: the carcinogen sterigmatocystin (the penultimate precursor to AF), and the antibiotic penicillin [<xref ref-type="bibr" rid="B11-toxins-04-00695">11</xref>]. Simultaneous loss of all three <italic>ppo</italic> genes shifts development from asexual to sexual reproduction [<xref ref-type="bibr" rid="B21-toxins-04-00695">21</xref>]. Loss of some of these genes in <italic>A. fumigatus</italic> leads to both altered spore development and toxin synthesis that affects the outcome of disease development in murine models of aspergillosis [<xref ref-type="bibr" rid="B22-toxins-04-00695">22</xref>,<xref ref-type="bibr" rid="B23-toxins-04-00695">23</xref>]. In <italic>A. flavus</italic>, simultaneous silencing via RNAi of four homologs of the <italic>A. nidulans</italic> dioxygenase genes (<italic>ppoA</italic>, <italic>ppoB</italic>, <italic>ppoC</italic>, and <italic>ppoD</italic>) and one lipoxygenase gene (<italic>loxA</italic>) yields a shift from asexual development to the production of sclerotia (the structure in <italic>A. flavus</italic> analogous to sexual reproductive structures in <italic>A. nidulans</italic>), with an increase in AF synthesis [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>,<xref ref-type="bibr" rid="B17-toxins-04-00695">17</xref>]. Furthermore, studies with <italic>A. flavus</italic> mutants suggest oxylipins regulate secondary metabolism and spore development via a density-dependent mechanism resembling quorum sensing [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>,<xref ref-type="bibr" rid="B17-toxins-04-00695">17</xref>]. </p>
      <p>Quorum sensing (QS) is a density-dependent phenomenon that leads to a coordinated response from the population, such as biofilm formation by <italic>Psuedomonas aeruginosa</italic> and bioluminescence by <italic>Vibrio fischeri</italic>. As the population grows, cells secrete an inducer molecule until it surpasses a certain threshold, activates its receptor, and initiates gene transcription. Although once thought to exist only in bacteria, QS systems are now well established in fungi [<xref ref-type="bibr" rid="B24-toxins-04-00695">24</xref>,<xref ref-type="bibr" rid="B25-toxins-04-00695">25</xref>]. Often lipid moieties including oxylipins are key to QS in fungi [<xref ref-type="bibr" rid="B26-toxins-04-00695">26</xref>]. For example, <italic>A. flavus</italic> undergoes a density-dependent shift in which, at low population densities, production of conidia is low, while production of sclerotia and AF is high. At high density the inverse is seen: production of sclerotia and AF is low, while conidiation is increased. <italic>A. flavus</italic> oxygenase mutants do not display this same pattern of development, suggesting that oxylipins are important in orchestrating this phenomenon [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>,<xref ref-type="bibr" rid="B17-toxins-04-00695">17</xref>]. Recent work with <italic>A. nidulans</italic> also supports an oxylipin-driven quorum sensing system that impacts spore germination [<xref ref-type="bibr" rid="B27-toxins-04-00695">27</xref>].</p>
      <p>The hypothesis that oxylipins—both <italic>Aspergillus</italic> and plant derived—could be involved in quorum sensing is also supported by several chemical induction studies. Notably, exposure to the exogenous seed oxylipins 9(<italic>S</italic>)-hydroperoxyoctadecadienoic (9(<italic>S</italic>)-HpODE) acid and 13(<italic>S</italic>)-hydroperoxyoctadecadienoic acid (13(<italic>S</italic>)-HpODE) stimulate sporulation and respectively enhance or inhibit sterigmatocystin/AF synthesis in <italic>A. nidulans</italic>, <italic>A. flavus</italic>, and <italic>A. parasiticus</italic> [<xref ref-type="bibr" rid="B28-toxins-04-00695">28</xref>,<xref ref-type="bibr" rid="B29-toxins-04-00695">29</xref>]. Furthermore, 13(<italic>S</italic>)-HpODE has been shown to inhibit sclerotial production by certain strains of <italic>A. flavus</italic> [<xref ref-type="bibr" rid="B29-toxins-04-00695">29</xref>]. Exogenous applications of mixtures of native <italic>Aspergillus</italic> oxylipins also shift the balance of asexual to sexual/sclerotial production in all three <italic>Aspergillus</italic> species [<xref ref-type="bibr" rid="B29-toxins-04-00695">29</xref>].</p>
      <p>Despite this extensive evidence for oxylipins as drivers of <italic>Aspergillus</italic> development and AF production, nothing is known about how fungi perceive oxylipins. In mammals, oxylipins are recognized by G protein-coupled receptors (GPCRs). For example, GPCRs are receptors for both prostaglandins (cyclooxygenase-generated oxylipins) and leukotrienes (lipoxygenase-generated oxylipins) involved in inflammation and asthma progression [<xref ref-type="bibr" rid="B30-toxins-04-00695">30</xref>,<xref ref-type="bibr" rid="B31-toxins-04-00695">31</xref>]. Mammalian cells also generate some of the same linoleic acid-derived oxylipins as plant cells, including the AF-inducing metabolite 9(<italic>S</italic>)-HpODE, its structural analog 9-hydroxyoctadecadienoic acid (9(<italic>S</italic>)-HODE), 13(<italic>S</italic>)-HpODE, and 13(<italic>S</italic>)-HODE [<xref ref-type="bibr" rid="B32-toxins-04-00695">32</xref>,<xref ref-type="bibr" rid="B33-toxins-04-00695">33</xref>]. These oxylipins are recognized by the human GPCR G2A [<xref ref-type="bibr" rid="B34-toxins-04-00695">34</xref>,<xref ref-type="bibr" rid="B35-toxins-04-00695">35</xref>,<xref ref-type="bibr" rid="B36-toxins-04-00695">36</xref>]. Although genome analysis has identified many fungal GPCRs [<xref ref-type="bibr" rid="B37-toxins-04-00695">37</xref>,<xref ref-type="bibr" rid="B38-toxins-04-00695">38</xref>,<xref ref-type="bibr" rid="B39-toxins-04-00695">39</xref>], the only currently known GPCR ligands are sugars, amino acids, peptide pheromones and photons [<xref ref-type="bibr" rid="B40-toxins-04-00695">40</xref>,<xref ref-type="bibr" rid="B41-toxins-04-00695">41</xref>]. Here we investigate the hypothesis that oxylipins are perceived by fungal GPCRs. We find that several oxylipins stimulate a burst in cAMP, a downstream event of GPCR activation, in <italic>A. nidulans</italic>, and this may be mediated at least in part by the GPCR GprD. We further report that the two putative homologs of GprD in <italic>A. flavus</italic>, GprC and GprD, are required for proper density-dependent development. When depleted of both receptors, the fungus is locked in a low density state, even when grown at high density, and does not respond to spent medium of a high density culture. </p>
    </sec>
    <sec sec-type="results">
      <title>2. Results and Discussion</title>
      <sec>
        <title>2.1. Oxylipins Exhibit Link to GPCR Signaling</title>
        <sec>
          <title>2.1.1. Oxylipins Induce a cAMP Burst in <italic>Aspergillus nidulans</italic></title>
          <p>A hallmark of G protein signaling is alteration of cAMP levels; indeed, binding of 9(<italic>S</italic>)-HODE to the mammalian GPCR, G2A, inhibits cAMP accumulation [<xref ref-type="bibr" rid="B35-toxins-04-00695">35</xref>]. Because the role of cAMP in development had already been described for the genetic model <italic>A. nidulans</italic> [<xref ref-type="bibr" rid="B42-toxins-04-00695">42</xref>,<xref ref-type="bibr" rid="B43-toxins-04-00695">43</xref>,<xref ref-type="bibr" rid="B44-toxins-04-00695">44</xref>,<xref ref-type="bibr" rid="B45-toxins-04-00695">45</xref>,<xref ref-type="bibr" rid="B46-toxins-04-00695">46</xref>], the first <italic>Aspergillus</italic> species studied for oxylipin developmental effects [<xref ref-type="bibr" rid="B19-toxins-04-00695">19</xref>], we measured cAMP levels in tissues of this fungus exposed to pure plant oxylipins. We first examined the wild type response to increasing concentrations of 13(<italic>S</italic>)-HpODE and found the cAMP burst to be released in a dose-dependent manner. Fungal tissues were treated with 12.5 μL EtOH containing increasing concentrations of 13(<italic>S</italic>)-HpODE with a resulting increasing production of cAMP (all <italic>p</italic> &lt; 0.05; <xref ref-type="fig" rid="toxins-04-00695-f001">Figure 1</xref>a). Previously, individual oxylipin species were measured in homogenized <italic>A. nidulans</italic> tissues at approximately 30 to 110 nmol/g dry weight [<xref ref-type="bibr" rid="B12-toxins-04-00695">12</xref>]. In the current study, assuming a water content of 70% in fungal tissues, 33 nanomoles oxylipin were added per gram dry weight when oxylipins were added at 100 nM and correspondingly more at higher concentrations (<xref ref-type="fig" rid="toxins-04-00695-f001">Figure 1</xref>a). At 10 μM, the cAMP response appeared to be at saturation (as also seen for 9(<italic>S</italic>)-HODE perceived by G2A [<xref ref-type="bibr" rid="B35-toxins-04-00695">35</xref>]), and increasing from 10 μM to 100 μM 13(<italic>S</italic>)-HpODE did not cause a significant difference in cAMP response (<italic>p</italic> = 0.6), so oxylipins were applied at 10 μM in subsequent experiments.</p>
          <fig id="toxins-04-00695-f001" position="anchor">
            <label>Figure 1</label>
            <caption>
              <p>(<bold>a</bold>) Samples were treated with EtOH (control) or an equivalent volume of 13(<italic>S</italic>)-HpODE dissolved in EtOH to achieve the final sample concentrations listed; (<bold>b</bold>) Samples were treated with EtOH (control) or an equivalent volume of pure oxylipin dissolved in EtOH to achieve a final sample concentration of 10 μM. For both (a) and (b), tissues were harvested as described, and cAMP concentrations were measured. Differing letters above bars in (<bold>a</bold>) denote treatments significantly different from one another (<italic>p</italic>≤ 0.05; one-tailed paired Student’s <italic>T</italic>-test). Differences from the EtOH control in (<bold>b</bold>) are denoted as follows: <bold>*</bold><italic>p</italic> &lt; 0.05; <bold>**</bold><italic>p</italic> &lt; 0.01, determined by one-tailed paired Student’s <italic>T</italic>-tests. </p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g001.tif"/>
          </fig>
          <p>The fungus was then examined for response to four oxylipins: 13(<italic>S</italic>)-HpODE, 9(<italic>S</italic>)-HpODE and their hydroxy derivatives, all of which activated the mammalian GPCR, G2A [<xref ref-type="bibr" rid="B35-toxins-04-00695">35</xref>]. These four metabolites are generated by both plant and mammalian lipoxygenases [<xref ref-type="bibr" rid="B32-toxins-04-00695">32</xref>,<xref ref-type="bibr" rid="B33-toxins-04-00695">33</xref>,<xref ref-type="bibr" rid="B47-toxins-04-00695">47</xref>,<xref ref-type="bibr" rid="B48-toxins-04-00695">48</xref>]. As seen in <xref ref-type="fig" rid="toxins-04-00695-f001">Figure 1</xref>b, wild type <italic>A. nidulans</italic> produced more cAMP after a twenty second exposure to each of these oxylipins than after a twenty second exposure to the same volume of EtOH carrier (all <italic>p</italic> &lt; 0.05). 9(<italic>S</italic>)-HpODE caused the smallest response; the other three oxylipins caused a nearly identical increase in cAMP. The act of grinding effectively spreads cAMP uniformly throughout tissues; however, local responses to oxylipins at the cellular level may have created much higher gradients of cAMP than we could measure with our methods. </p>
          <p>As a final control to confirm accuracy of our methodology, we assessed an adenylate cyclase mutant (<italic>∆cyaA</italic>, [<xref ref-type="bibr" rid="B44-toxins-04-00695">44</xref>]) and its parental wild type <italic>cyaA</italic> strain for their responses to 13(<italic>S</italic>)-HpODE. Adenylate cyclase is required for activation of cAMP release. As expected, addition of 13(<italic>S</italic>)-HpODE to the wild type increased cAMP production 1.8 fold over the EtOH control (<italic>p</italic> = 0.05). However, there was no significant difference between samples of the <italic>∆cyaA</italic> mutant treated with EtOH or 13(<italic>S</italic>)-HpODE (<italic>p</italic> = 1.4; <xref ref-type="fig" rid="toxins-04-00695-f007">Figure S1</xref>).</p>
          </sec>
        <sec>
          <title>2.1.2. An <italic>A. nidulans ∆gprD</italic> Mutant Does Not Accumulate cAMP in Response to Oxylipins</title>
          <p>Having established the cAMP response to oxylipins, we next assessed a series of GPCR mutants for alterations in oxylipin response. As a preliminary screen, we first assessed the ability of the ten GPCR deletion mutants that were constructed at the time of this study (<italic>∆gprA</italic>, <italic>∆gprB</italic>, <italic>∆gprC</italic>, <italic>∆gprD</italic>, <italic>∆gprE</italic>, <italic>∆gprF</italic>, <italic>∆gprG</italic>, <italic>∆gprH</italic>, <italic>∆gprI</italic>,and <italic>∆gprK</italic>, <xref ref-type="table" rid="toxins-04-00695-t001">Table 1</xref>) to respond to polyunsaturated fatty acid (linoleic and arachidonic acids) saturated discs by hyper-conidiation. This method provides a rapid and inexpensive screen for lack of response to oxylipins [<xref ref-type="bibr" rid="B29-toxins-04-00695">29</xref>]. Of the ten GPCR mutants, <italic>∆gprA</italic> and <italic>∆gprD</italic> mutants did not exhibit hyper-conidiation when exposed to 0.5 and 1 mg fatty acid-soaked discs, with <italic>∆gprD</italic> showing the greatest defect (data not shown). </p>
          <table-wrap id="toxins-04-00695-t001" position="float">
            <object-id pub-id-type="pii">toxins-04-00695-t001_Table 1</object-id>
            <label>Table 1</label>
            <caption>
              <p>All strains used in this study and their genotypes.</p>
            </caption>
            <table>
              <thead>
                <tr>
                  <th align="center" valign="middle">Species</th>
                  <th align="center" valign="middle">Strain</th>
                  <th align="center" valign="middle">Genotype</th>
                  <th align="center" valign="middle">Source</th>
                </tr>
              </thead>
              <tbody>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RDIT9.32</td>
                  <td align="center" valign="middle">Wild type (
                  <italic>veA</italic>)</td>
                  <td align="center" valign="middle">[<xref ref-type="bibr" rid="B19-toxins-04-00695">19</xref>]</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RKIS1</td>
                  <td align="center" valign="middle"><italic>pabaA1</italic>; <italic>yA2</italic>; <italic>veA1</italic></td>
                  <td align="center" valign="middle">[<xref ref-type="bibr" rid="B44-toxins-04-00695">44</xref>]</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RKIS47.1</td>
                  <td align="center" valign="middle"><italic>pabaA1</italic>; <italic>yA2</italic>; <italic>∆cyaA::pyrG</italic>; <italic>veA1</italic></td>
                  <td align="center" valign="middle">[<xref ref-type="bibr" rid="B44-toxins-04-00695">44</xref>]</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RDWC2.2</td>
                  <td align="center" valign="middle"><italic>∆gprA::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RDWC7.2</td>
                  <td align="center" valign="middle"><italic>∆gprB::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RDWC4.5</td>
                  <td align="center" valign="middle"><italic>∆gprC::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RDWC5.4</td>
                  <td align="center" valign="middle"><italic>∆gprD::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">rJH12.9</td>
                  <td align="center" valign="middle"><italic>∆gprE::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">rJH21.1</td>
                  <td align="center" valign="middle"><italic>∆gprF::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RDWC1.2</td>
                  <td align="center" valign="middle"><italic>∆gprG::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">rJH34.12</td>
                  <td align="center" valign="middle"><italic>∆gprH::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">rJH42.14</td>
                  <td align="center" valign="middle"><italic>∆gprI::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RDWC6.5</td>
                  <td align="center" valign="middle"><italic>∆gprK::argB</italic>; <italic>veA</italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">TJAR39</td>
                  <td align="center" valign="middle"><italic>yA2</italic>; <italic>pabaA1</italic>; <italic>∆gprA::argB</italic>; <italic>argB2</italic>; <italic>veA1</italic></td>
                  <td align="center" valign="middle">[<xref ref-type="bibr" rid="B49-toxins-04-00695">49</xref>]</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">TKH3.33</td>
                  <td align="center" valign="middle"><italic>metG1</italic>; <italic>biA1</italic>; <italic>∆gprB::argB</italic>; <italic>argB2</italic>; <italic>veA1</italic> </td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RKH68.8</td>
                  <td align="center" valign="middle"><italic>yA2</italic>; <italic>pabaA1</italic>; <italic>∆gprC::argB</italic>; <italic>argB2</italic>; <italic>veA1</italic></td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RKH57.25</td>
                  <td align="center" valign="middle"><italic>biA1</italic>; <italic>∆gprD::argB</italic>; <italic>argB2</italic>; <italic>veA1</italic></td>
                  <td align="center" valign="middle">[<xref ref-type="bibr" rid="B50-toxins-04-00695">50</xref>]</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">RKH75.2</td>
                  <td align="center" valign="middle"><italic>yA2</italic>; <italic>metG1</italic>; <italic>pabaA1</italic>; <italic>biA1</italic>; <italic>∆gprG::argB</italic>; <italic>veA1</italic></td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. nidulans</italic>
                  </td>
                  <td align="center" valign="middle">TJAR13</td>
                  <td align="center" valign="middle"><italic>∆gprK::argB</italic>; <italic>argB2</italic>; <italic>veA1</italic></td>
                  <td align="center" valign="middle">J.-H. Yu, UW-Madison</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. flavus</italic>
                  </td>
                  <td align="center" valign="middle">NRRL3357</td>
                  <td align="center" valign="middle">Wild type</td>
                  <td align="center" valign="middle">[<xref ref-type="bibr" rid="B51-toxins-04-00695">51</xref>]</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. flavus</italic>
                  </td>
                  <td align="center" valign="middle">3357-5</td>
                  <td align="center" valign="middle">
                    <italic>pyrG<sup>-</sup></italic>
                  </td>
                  <td align="center" valign="middle">[<xref ref-type="bibr" rid="B51-toxins-04-00695">51</xref>]</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. flavus</italic>
                  </td>
                  <td align="center" valign="middle">TKJA10.1</td>
                  <td align="center" valign="middle"><italic>∆gprC::pyrG</italic>; <italic>pyrG<sup>-</sup></italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. flavus</italic>
                  </td>
                  <td align="center" valign="middle">TKJA8.1</td>
                  <td align="center" valign="middle"><italic>∆gprD::pyrG</italic>; <italic>pyrG<sup>-</sup></italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
                <tr>
                  <td align="center" valign="middle">
                    <italic>A. flavus</italic>
                  </td>
                  <td align="center" valign="middle">TKJA14.2</td>
                  <td align="center" valign="middle"><italic>gprC</italic>; <italic> gprD IRT::pyrG</italic>; <italic>pyrG<sup>-</sup></italic></td>
                  <td align="center" valign="middle">This study</td>
                </tr>
              </tbody>
            </table>
          </table-wrap>
          <p>To better assess the possibility that GprA or GprD might be involved in oxylipin perception, <italic>A. nidulans</italic> ∆<italic>gprA</italic> and ∆<italic>gprD</italic> strains, as well as ∆<italic>gprG,</italic> a randomly chosen GPCR deletion mutant exhibiting the wild type conidiation response to linoleic acid, were then assessed for their cAMP response to four pure oxylipins: 13(<italic>S</italic>)-HpODE, 9(<italic>S</italic>)-HpODE, 13(<italic>S</italic>)-HODE and 9(<italic>S</italic>)-HODE. As shown in <xref ref-type="fig" rid="toxins-04-00695-f002">Figure 2</xref>, both <italic>∆gprA</italic> and <italic>∆gprG</italic> produced significantly more cAMP when exposed to each of the four oxylipins than when treated with an equivalent volume of EtOH (all <italic>p</italic> &lt; 0.05). In contrast, the <italic>∆gprD</italic> mutant did not respond to any of the four oxylipins with an increase in cAMP concentrations over that of the EtOH control (all <italic>p</italic> &gt; 0.1). </p>
          <fig id="toxins-04-00695-f002" position="anchor">
            <label>Figure 2</label>
            <caption>
              <p>(<bold>a</bold>) <italic>A. nidulans</italic> wild type and <italic>∆gprA</italic> were treated with EtOH (control) or 10 μM oxylipin in EtOH, tissues were harvested, and cAMP concentrations were measured; (<bold>b</bold>) <italic>A. nidulans</italic> wild type and <italic>∆gprD</italic> were treated with EtOH (control) or 10 μM oxylipin in EtOH, tissues were harvested, and cAMP concentrations were measured; (<bold>c</bold>) <italic>A. nidulans</italic> wild type and <italic>∆gprG</italic> were treated with EtOH (control) or 10 μM oxylipin in EtOH, tissues were harvested, and cAMP concentrations were measured. Differences from the EtOH control in (a), (b), and (c) are denoted as follows: <bold>*</bold><italic>p</italic> &lt; 0.05; <bold>**</bold><italic>p</italic> &lt; 0.01, determined by one-tailed paired Student’s <italic>T</italic>-tests.</p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g002.tif"/>
          </fig>
        </sec>
      </sec>
      <sec>
        <title>2.2. Putative GprD Homologues Are Involved in Density-Dependent Development in <italic>A. flavus</italic></title>
        <sec>
          <title>2.2.1. <italic>A. flavus</italic> Encodes Two Putative Homologues of <italic>A. nidulans</italic> GprD</title>
          <p>Because of the growth and sporulation defects of the <italic>A. nidulans ∆gprD</italic> strain [<xref ref-type="bibr" rid="B50-toxins-04-00695">50</xref>] and it not being a pathogen of note, we followed up with physiology studies with mutants of the homologous <italic>gprD</italic> genes in the agriculturally relevant species, <italic>A. flavus.</italic> As <italic>A. nidulans</italic> is a model organism for other filamentous fungi, including <italic>A. flavus</italic>, we reasoned that if GprD was involved in oxylipin perception, then it could play a role in <italic>A. flavus</italic> biology, as <italic>A. flavus</italic> oxylipin mutants are aberrant in spore and sclerotial development [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>,<xref ref-type="bibr" rid="B17-toxins-04-00695">17</xref>]. <italic>A. nidulans</italic> encodes at least sixteen putative GPCRs [<xref ref-type="bibr" rid="B38-toxins-04-00695">38</xref>]. BLAST searches querying each of these GPCRs identified fifteen putative GPCRs in <italic>A. flavus</italic>. Of these, two appear to be highly similar to <italic>A. nidulans</italic> GprD. The first of these is <italic>A. flavus</italic> GprD (AFLA_135680), which shares 67% amino acid identity (e-value 2e-164) with <italic>A. nidulans</italic> GprD. The second we call GprC (AFLA_074150), and it shares 47% identity (e-value 6e-87) with <italic>A. nidulans</italic> GprD and 47% identity with <italic>A. flavus</italic> GprD (e-value 1e-119). An alignment of all three GPCRs is provided in <xref ref-type="fig" rid="toxins-04-00695-f008">Figure S2</xref>.</p>
          <p>Individual deletion mutants of both <italic>gprC</italic> and <italic>gprD</italic> were created by replacing each gene with <italic>pyrG</italic> (<xref ref-type="table" rid="toxins-04-00695-t001">Table 1</xref>, <xref ref-type="fig" rid="toxins-04-00695-f009">Figure S3</xref>). A third strain, <italic>KD::gprCD</italic> (for “knock-down of <italic>gprC</italic> and <italic>gprD</italic>”) with both genes down-regulated by RNAi [<xref ref-type="bibr" rid="B52-toxins-04-00695">52</xref>], was also created with the thought that the two proteins may have overlapping function due to their high identity (<xref ref-type="table" rid="toxins-04-00695-t001">Table 1</xref>, <xref ref-type="fig" rid="toxins-04-00695-f009">Figure S3</xref>). All mutants were confirmed with Southern blots, and in the case of <italic>KD::gprCD</italic>, Northern blots as well (<xref ref-type="fig" rid="toxins-04-00695-f009">Figure S3</xref>).</p>
          </sec>
        <sec>
          <title>2.2.2. <italic>gprC</italic> and <italic>gprD</italic> Mutants Exhibit Aberrant Density-Dependent Development</title>
          <p>Considering the critical role of oxylipins in <italic>A. flavus</italic> quorum sensing development and the possibility that GprC/D could be involved in oxylipin perception, the <italic>A. flavus</italic> GprC and GprD mutants were examined for density dependent development. The fungi were grown at low (10<sup>3</sup> spores per plate) and high (10<sup>7</sup> spores per plate) densities, and production of conidia, sclerotia, and AF were measured after seven days (<xref ref-type="fig" rid="toxins-04-00695-f003">Figure 3</xref>). At low density, there were subtle differences between the mutants and wild type (NRRL3357), but the most striking differences were seen at high density. Here, production of conidia was high in the wild type, but it was reduced 2.3 fold in the <italic>∆gprC</italic> strain and was almost completely absent in the <italic>KD::gprCD</italic> mutant (both <italic>p</italic> &lt; 0.001, <xref ref-type="fig" rid="toxins-04-00695-f003">Figure 3</xref>a,d). Conversely, sclerotia production was minimal in the wild type at high density. As seen in <xref ref-type="fig" rid="toxins-04-00695-f003">Figure 3</xref>b,d, all three mutants exhibited profound increases in sclerotia production at high density. The <italic>∆gprC</italic> and <italic>∆gprD</italic> strains produced 35.8 and 30.9 fold more sclerotia, respectively, than the wild type, while the <italic>KD::gprCD</italic> strain produced 60.7 fold more sclerotia than the wild type, approximately doubling what the two single mutants produced (all <italic>p</italic> &lt; 0.001). AF biosynthesis was also regulated in response to population density changes, being up-regulated at low density and down-regulated at high density as previously reported [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>]. The <italic>∆gprD</italic> and <italic>KD::gprCD</italic> mutants showed modest increases in AF compared to the wild type at low density. Most remarkably, the <italic>KD::gprCD</italic> mutant produced more AF at high density than wild type AF production at the favorable low density conditions (<xref ref-type="fig" rid="toxins-04-00695-f003">Figure 3</xref>e).</p>
          <fig id="toxins-04-00695-f003" position="anchor">
            <label>Figure 3</label>
            <caption>
              <p>(<bold>a</bold>) Conidia produced by low density and high density cultures were counted; (<bold>b</bold>) Sclerotia were collected from low density and high density cultures, and their dry weight was measured; (<bold>c</bold>) Aflatoxin (AF) was extracted from low density and high density cultures, separated by thin layer chromatography (TLC), and visualized under 366-nm light. The absolute intensities of the AF spots were calculated as described in the Experimental section. For all three graphs in (a), (b), and (c), the data were analyzed using one-way ANOVA and a Tukey post-test. Different letters represent statistically significant differences (<italic>p</italic> &lt; 0.05), with lowercase letters used for low-density data and uppercase letters used for high-density data; (<bold>d</bold>) A sample of the plates is shown, containing a full set of high-density plates (top four panels) both before (“Unwashed”) and after (“Washed”) washing off conidia. The wild type at low density (lowest panel) is also included for a point of reference; (<bold>e</bold>) The TLC plates for low and high density cultures are shown here. An AF standard was run on either side of the plates.</p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g003.tif"/>
          </fig>
        </sec>
      </sec>
      <sec>
        <title>2.3. GprC and GprD Are Required for Proper Responses to Spent Media Extracts</title>
        <sec>
          <title>2.3.1. High Density Extracts</title>
          <p>Because it appeared that depletion of both <italic>gprC</italic> and <italic>gprD</italic> caused the fungus to stay locked in a low-density development pattern, we hypothesized that these receptors may be required for transmitting a signal produced at high density. The extract from the spent medium of a high density culture induced a significant increase in conidiation in the wild type [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>], so this extract and an extract from un-inoculated plates (media control) were applied to cultures of the <italic>gprC</italic> and <italic>gprD</italic> mutants (<xref ref-type="fig" rid="toxins-04-00695-f004">Figure 4</xref>). As previously reported, the high-density extract stimulated a significant increase in conidiation when applied to the wild type (<italic>p</italic> = 0.002). In contrast to wild type, conidiation for all three mutants appeared to be slightly decreased in response to the high-density extract, though this was only minimally significant for the <italic>∆gprC</italic> strain (<italic>p</italic> = 0.049). </p>
          <fig id="toxins-04-00695-f004" position="anchor">
            <label>Figure 4</label>
            <caption>
              <p>(<bold>a</bold>) Spores were counted from strains grown on plates containing extracts from uninoculated media (light gray bars) or spent medium of high-density wild type cultures (dark gray bars). The spore counts from plates with the media control extract were set to one, and the spore counts from the same strain exposed to the high-density extract were expressed in relation to the media control counts. Differences between the two treatments for each strain are denoted as follows: <bold>*</bold><italic>p</italic> &lt; 0.05; <bold>**</bold><italic>p</italic> &lt; 0.01, determined by two-tailed unpaired Student’s <italic>T</italic>-tests; (<bold>b</bold>) A sample of the plates is shown, containing a set of cultures exposed to the media control extract (light gray bar) and a set exposed to the high-density wild type extract (dark gray bar).</p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g004.tif"/>
          </fig>
        </sec>
        <sec>
          <title>2.3.2. <italic>gprC</italic> and <italic>gprD</italic> Mutants Respond to Linoleic Acid</title>
          <p>Next the three mutants were assessed for their ability to respond to linoleic acid (LA), a known inducer of conidiation in <italic>A. flavus</italic> [<xref ref-type="bibr" rid="B29-toxins-04-00695">29</xref>]. Conidiation was measured in response to disks containing 1 mg LA or an ethanol control (<xref ref-type="fig" rid="toxins-04-00695-f005">Figure 5</xref>). As previously reported, the wild type exhibited a significant increase in conidiation in response to LA (<italic>p</italic> = 0.003). In a similar fashion, all three mutants also produced significantly more conidia when exposed to LA (<italic>p</italic> = 0.002 for <italic>∆gprC</italic>, <italic>p</italic> = 0.001 for <italic>∆gprD</italic>, and <italic>p</italic> = 0.0008 for <italic>KD::gprCD</italic>). Although the relative increase in conidiation for the <italic>KD::gprCD</italic> strain from the ethanol control, 5.5-fold, was greater than that of any other strain tested, it still produced fewer conidia than any of the other strains (data not shown), as seen in the previous experiments. </p>
          <fig id="toxins-04-00695-f005" position="anchor">
            <label>Figure 5</label>
            <caption>
              <p>Spores were counted from the area of a plate surrounding a disk soaked with ethanol or linoleic acid in ethanol. The counts from the ethanol control disks were set to one, and the spore totals from the same strain exposed to linoleic acid (dark gray bars) were expressed relative to the ethanol control spore counts (light gray bars). Differences between the two treatments for each strain are denoted as follows: <bold>*</bold><italic>p</italic> &lt; 0.05; <bold>**</bold><italic>p</italic> &lt; 0.01; <bold>***</bold><italic>p</italic> &lt; 0.001, determined by two-tailed unpaired Student’s <italic>T</italic>-tests.</p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g005.tif"/>
          </fig>
        </sec>
      </sec>
      <sec>
        <title>2.4. Discussion</title>
        <p>This study has revealed several important findings. First of all, we have shown that <italic>A. nidulans</italic> responds to several plant oxylipins with a burst in cAMP in a dose-dependent manner (<xref ref-type="fig" rid="toxins-04-00695-f001">Figure 1</xref> and <xref ref-type="fig" rid="toxins-04-00695-f002">Figure 2</xref>). Activation of a GPCR and subsequent activation and dissociation of the heterotrimeric G protein can lead to activation of adenylate cyclase, which converts ATP to cAMP. cAMP then catalyzes the release of protein kinase A (PKA) inhibitory subunits, resulting in activation of the kinase. Mutations made at various steps in this pathway in <italic>A. nidulans</italic> affect germination, sporulation, and secondary metabolism including mycotoxin synthesis [<xref ref-type="bibr" rid="B42-toxins-04-00695">42</xref>,<xref ref-type="bibr" rid="B43-toxins-04-00695">43</xref>,<xref ref-type="bibr" rid="B44-toxins-04-00695">44</xref>,<xref ref-type="bibr" rid="B45-toxins-04-00695">45</xref>,<xref ref-type="bibr" rid="B46-toxins-04-00695">46</xref>]. These same developmental events are also greatly impacted in <italic>A. nidulans</italic> by applications of both endogenous and exogenous oxylipins [<xref ref-type="bibr" rid="B29-toxins-04-00695">29</xref>], and our findings that oxylipins stimulate accumulation of cAMP provides evidence that oxylipins could be ligands initiating the PKA signaling pathway. Furthermore, the <italic>A. nidulans ∆gprD</italic> mutant did not exhibit a cAMP burst in response to plant oxylipins (<xref ref-type="fig" rid="toxins-04-00695-f002">Figure 2</xref>), suggesting that GprD may be an oxylipin receptor. Although no fungal GPCR has yet been identified as an oxylipin receptor, several classes of mammalian GPCRs sense a variety of oxylipins, including prostaglandins, leukotrienes, and the 9(<italic>S</italic>)-HpODE and 13(<italic>S</italic>)-HpODE oxylipins and their derivatives [<xref ref-type="bibr" rid="B30-toxins-04-00695">30</xref>,<xref ref-type="bibr" rid="B31-toxins-04-00695">31</xref>,<xref ref-type="bibr" rid="B36-toxins-04-00695">36</xref>].</p>
        <p><italic>In silico</italic> analysis of GprD identified two putative homologs in <italic>A. flavus</italic>, GprC and GprD (<xref ref-type="fig" rid="toxins-04-00695-f008">Figure S2</xref>). Assessment of conidial and sclerotial production of individual deletion mutants as well as the double mutant <italic>KD::gprCD</italic> compared with the wild type demonstrate that GprC and GprD share overlapping functions in regulating density-dependent development (<xref ref-type="fig" rid="toxins-04-00695-f003">Figure 3</xref>). In every case, the differences between the wild type and the <italic>KD::gprCD</italic> strain were at least as—or often more—severe than those observed between the single mutants and wild type. Overall, the most striking differences between the wild type and the mutants occurred when grown at high-density. High density cultures of the <italic>KD::gprCD</italic> strain produced low amounts of conidia and high amounts of sclerotia and AF, mimicking a wild type low density culture. Moreover, the <italic>KD::gprCD</italic> mutant did not conidiate in response to spent media from a wild type high density culture (<xref ref-type="fig" rid="toxins-04-00695-f004">Figure 4</xref>), further suggesting that the loss of GprC and GprD locks the fungus into a low density state. Interestingly, this mutant was able to conidiate in response to linoleic acid (<xref ref-type="fig" rid="toxins-04-00695-f005">Figure 5</xref>), suggesting that the lack of response to the high density extract was signal-specific, and not due to a general conidiation defect. </p>
		<fig id="toxins-04-00695-f006" position="anchor">
          <label>Figure 6</label>
          <caption>
            <p>A hypothetical model is presented in which at low density, cultures of <italic>A. flavus</italic> produce low amounts of oxylipins (via Ppo and/or Lox enzymes). GprC/D signaling is not activated, and the culture produces AF and sclerotia, but very few conidia. At high density, more oxylipins are produced until their levels exceed a threshold and are recognized by GprC and GprD. This initiates a developmental shift toward conidiation, while very low amounts of sclerotia and AF are produced.</p>
          </caption>
          <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g006.tif"/>
        </fig>
      
        <p>The phenotypes of the <italic>gpr</italic> mutants recapitulated those observed for several of the <italic>A. flavus</italic> oxygenase mutants, in particular strains deleted for the sole lipoxygenase gene, <italic>loxA</italic> and one of the <italic>ppo</italic> genes, <italic>ppoC</italic> [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>,<xref ref-type="bibr" rid="B17-toxins-04-00695">17</xref>]. Loss of either one of these genes similarly locked the fungus into a low density phenotype. Like that of the <italic>KD::gprCD</italic> mutant, the severity of the phenotype was additive in <italic>A. flavus</italic> strains depleted for the <italic>lox</italic> and multiple <italic>ppo</italic> genes. Considering these data together, we present a hypothetical model for GprC/D perception of endogenous oxylipins (<xref ref-type="fig" rid="toxins-04-00695-f006">Figure 6</xref>). We propose that at high-densities, a QS signal triggers wild type cultures to make very little AF and few sclerotia while conidiating profusely. GprC and GprD could be direct receptors of this signal(s), which could be generated by Lox and/or Ppo enzymes. Without these receptors or the enzymes that produce the signals, the fungus remains in a low-density state. Endogenous oxylipins are likely similar in structure to exogenous, plant derived oxylipins, and thus GprC and GprD could be important for fungal-host interactions.</p>
        </sec>
    </sec>
    <sec>
      <title>3. Experimental Section</title>
      <sec>
        <title>3.1. Culture Conditions</title>
        <p>Strains (<xref ref-type="table" rid="toxins-04-00695-t001">Table 1</xref>) were grown on glucose minimal medium (GMM) (6.0 g NaNO<sub>3</sub>, 0.52 g KCl, 0.52 g MgSO<sub>4</sub>·7H<sub>2</sub>O, 1.52 g KH<sub>2</sub>PO<sub>4</sub>, 1 mL trace elements stock solution (2.2 g ZnSO<sub>4</sub>·7H<sub>2</sub>O, 1.1 g H<sub>3</sub>BO<sub>3</sub>, 0.5 g MnCl<sub>2</sub>·4H<sub>2</sub>O, 0.5 g FeSO<sub>4</sub>·7H<sub>2</sub>O, 0.16 g CoCl<sub>2</sub>·5H<sub>2</sub>O, 0.16 g CuSO<sub>4</sub>·5H<sub>2</sub>O, 0.11 g (NH<sub>4</sub>)<sub>6</sub>Mo<sub>7</sub>O<sub>24</sub>·4H<sub>2</sub>O, 5.0 g Na<sub>4</sub>EDTA in 100 mL distilled H<sub>2</sub>O), 10 g glucose, 15 g agar, pH 6.5, in 1 L distilled H<sub>2</sub>O) unless mentioned otherwise. RKIS1 and RKIS47.1 were grown in medium supplemented with 0.001% para-amino benzoic acid. We forced sporulation of the <italic>ΔcyaA</italic> mutant RKIS47.1 by amending GMM with 0.8 M sorbitol; for uniformity, in the experiment depicted in <xref ref-type="fig" rid="toxins-04-00695-f007">Figure S1</xref>, spores for both RKIS1 and RKIS47.1 were generated on GMM + 0.8 M sorbitol. For genomic DNA extraction, strains were grown on liquid GMM with 0.5% yeast extract added. </p>
      </sec>
      <sec>
        <title>3.2. Strain Construction</title>
        <p>Strain genotypes and sources are summarized in <xref ref-type="table" rid="toxins-04-00695-t001">Table 1</xref>. Here, we describe in detail the construction of the <italic>A. flavus</italic> strains generated for this study. All primers are listed in <xref ref-type="table" rid="toxins-04-00695-t002">Table 2</xref><italic>. gprC</italic> and <italic>gprD</italic> were disrupted using homologous recombination to replace the gene with <italic>pyrG</italic> in the parental strain 3357-5 [<xref ref-type="bibr" rid="B51-toxins-04-00695">51</xref>] (<xref ref-type="fig" rid="toxins-04-00695-f007">Figure S1</xref>a). The <italic>gprC</italic> 5' and 3' flanks were amplified with primers 1 and 2 and primers 3 and 4, respectively. The <italic>gprD</italic> 5' and 3' flanks were amplified with primers 5 and 6 and primers 7 and 8, respectively. <italic>A. fumigatus pyrG</italic> was amplified from genomic DNA using primers 9 and 10, and <italic>A. parasiticus pyrG</italic> was amplified from the plasmid pJMP7 using primers 11 and 12. Primers 1 and 4 and primers 5 and 8 were used to amplify the entire deletion constructs for <italic>gprC</italic> and <italic>gprD</italic>, respectively. </p>
        <p>To deplete both <italic>gprC</italic> and <italic>gprD</italic> transcripts in one strain using RNAi, the strategy laid out in McDonald <italic>et al</italic>. [<xref ref-type="bibr" rid="B52-toxins-04-00695">52</xref>] was employed (<xref ref-type="fig" rid="toxins-04-00695-f007">Figure S1</xref>b), briefly described here: primers 13 and 14 and primers 15 and 16 were used to amplify ~500 bp of <italic>gprC</italic> and <italic>gprD</italic> coding regions, respectively. A single-joint PCR reaction was carried out with primers 13 and 16 to join the two fragments together and attach the appropriate restriction sites. The fragment was digested with <italic>Asc</italic>I and <italic>Nco</italic>I and ligated into pTMH44.2 [<xref ref-type="bibr" rid="B52-toxins-04-00695">52</xref>] to form pKJA23. The same fragment was then digested with <italic>Bam</italic>HI and <italic>Hin</italic>dIII and ligated into pKJA23 to form pKJA26, containing inverted repeats with a Green Fluorescent Protein (GFP) spacer in between. <italic>pyrG</italic> was cut from pJW66.3 [<xref ref-type="bibr" rid="B22-toxins-04-00695">22</xref>] using <italic>Eco</italic>RI and ligated into pKJA26 to form the final plasmid to be used for transformation into 3357-5 [<xref ref-type="bibr" rid="B51-toxins-04-00695">51</xref>], pKJA27. </p>
		<table-wrap id="toxins-04-00695-t002" position="float">
          <object-id pub-id-type="pii">toxins-04-00695-t002_Table 2</object-id>
          <label>Table 2</label>
          <caption>
            <p>All oligonucleotide primers used in this study.</p>
          </caption>
          <table>
  <thead>
              <tr>
                <th align="center" valign="middle">No.</th>
                <th align="center" valign="middle">Name</th>
                <th align="center" valign="middle">Sequence (5' to 3')</th>
              </tr>
  </thead>
  <tbody>
              <tr>
                <td align="center" valign="middle">
                  <italic>1</italic>
                </td>
                <td align="left" valign="middle">KS AflgprC 5'fk F</td>
                <td align="left" valign="middle">ttcctgcggcggttcattcc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>2</italic>
                </td>
                <td align="left" valign="middle">KS AflgprC 5'fk+AfupyrG R</td>
                <td align="left" valign="middle">cgaagagggtgaagagcattgtttgaggcagtataagccagtcgtcgtgc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>3</italic>
                </td>
                <td align="left" valign="middle">KS AfupyrG+AflgprC 3'fk F</td>
                <td align="left" valign="middle">gtgacgacaatacctcccgacgatacctggagtgaccggtcgagcaaagg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>4</italic>
                </td>
                <td align="left" valign="middle">KS AflgprC 3'fk R</td>
                <td align="left" valign="middle">agcggttaagttctgtgtcc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>5</italic>
                </td>
                <td align="left" valign="middle">KS Afl gprD 5'fk F</td>
                <td align="left" valign="middle">tcatatatccagtcccagtc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>6</italic>
                </td>
                <td align="left" valign="middle">KS Afl gprD+AppyrG 5'fk R</td>
                <td align="left" valign="middle">ctcgggccatctgttcgtataagctttgttcatctcttgaggtgg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>7</italic>
                </td>
                <td align="left" valign="middle">KS AppyrG+Afl gprD 3'fk F</td>
                <td align="left" valign="middle">agatccataggatcagcttatcgatgagtgtaccaggagactacg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>8</italic>
                </td>
                <td align="left" valign="middle">KS Afl gprD 3'fk R</td>
                <td align="left" valign="middle">tgagacggatgtatggcttg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>9</italic>
                </td>
                <td align="left" valign="middle">KS Ap pyrG pJMP7 F</td>
                <td align="left" valign="middle">agcttatacgaacagatggc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>10</italic>
                </td>
                <td align="left" valign="middle">KS Ap pyrG pJMP7 R</td>
                <td align="left" valign="middle">tcgataagctgatcctatgg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>11</italic>
                </td>
                <td align="left" valign="middle">KS Afu pyrG F</td>
                <td align="left" valign="middle">tgcctcaaacaatgctcttc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>12</italic>
                </td>
                <td align="left" valign="middle">KS Afu pyrG R</td>
                <td align="left" valign="middle">ccaggtatcgtcgggaggt</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>13</italic>
                </td>
                <td align="left" valign="middle">KS H-N-AflgprD F</td>
                <td align="left" valign="middle">tataaagcttccatgggcttaatggtgaggatgctc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>14</italic>
                </td>
                <td align="left" valign="middle">KS AflgprD-gprC R2</td>
                <td align="left" valign="middle">catgatggcgtaaaggcagacagtcccgaatcctagcacgataatgaagg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>15</italic>
                </td>
                <td align="left" valign="middle">KS AflgprD-gprC F2</td>
                <td align="left" valign="middle">ggactatgggccttcattatcgtgctaggattcgggactgtctgcctttac</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>16</italic>
                </td>
                <td align="left" valign="middle">KS AflgprC-A-B R2</td>
                <td align="left" valign="middle">tataggatccggcgcgccatcgtcgtcttcacggtgtc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>17</italic>
                </td>
                <td align="left" valign="middle">KS AflgprD2 ck F</td>
                <td align="left" valign="middle">gcttgacctggaaactttgc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>18</italic>
                </td>
                <td align="left" valign="middle">KS AflgprD2 ck R</td>
                <td align="left" valign="middle">gatgatacggagacagaatg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>19</italic>
                </td>
                <td align="left" valign="middle">KS JP M13 F</td>
                <td align="left" valign="middle">gtaaaacgacggccagtg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>20</italic>
                </td>
                <td align="left" valign="middle">KS JP M13 R</td>
                <td align="left" valign="middle">ggaaacagctatgaccatg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>21</italic>
                </td>
                <td align="left" valign="middle">KS AflgprC int F</td>
                <td align="left" valign="middle">cctttaccttcagcccaacg</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>22</italic>
                </td>
                <td align="left" valign="middle">KS AflgprC int R</td>
                <td align="left" valign="middle">atcagtccgagtgtgcttgc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>23</italic>
                </td>
                <td align="left" valign="middle">KS AflgprD int F</td>
                <td align="left" valign="middle">gcttaatggtgaggatgctc</td>
              </tr>
              <tr>
                <td align="center" valign="middle">
                  <italic>24</italic>
                </td>
                <td align="left" valign="middle">KS AflgprD int R</td>
                <td align="left" valign="middle">tgcgttcgagttggagtaag</td>
              </tr>
  </tbody>
          </table>
        </table-wrap>
        
        <p>Transformation of the fungus was carried out according to the protocol of Szewczyk <italic>et al</italic>. [<xref ref-type="bibr" rid="B53-toxins-04-00695">53</xref>] with the following modifications: 200 mg of <italic>Trichoderma</italic> lysing enzymes (Sigma Aldrich, St. Louis, MO, USA) were added to 10 mL KCl protoplasting solution, and the protoplasts were plated on sorbitol minimal medium (SMM) (GMM plus 1.2 M sorbitol). All strains were confirmed by PCR (data not shown) and Southern analysis (<xref ref-type="fig" rid="toxins-04-00695-f009">Figure S3</xref>c-e), and in the case of the <italic>IRTgprCD</italic> strain, Northern analysis as well (<xref ref-type="fig" rid="toxins-04-00695-f009">Figure S3</xref>f). The primers used for the <italic>∆gprC</italic> and <italic>∆gprD</italic> Southern probes are primers 17 and 18 and primers 5 and 8, respectively. The primers used for the <italic>IRTgprCD</italic> Southern probe are primers 19 and 20, which amplify the <italic>A. nidulans gpdA</italic> promoter found in pTMH44.2. The primers used for the <italic>IRTgprCD</italic> Northern probes are primers 21 and 22 and primers 23 and 24. Samples for Northern blotting were grown according to these conditions: 10<sup>6</sup> spores/mL in 50 mL liquid GMM in a 125-mL flask, with shaking at 30 °C at 250 r.p.m for 24 h. RNA was extracted using Isol-RNA Lysis Reagent (5 PRIME, Gaithersburg, MD, USA). </p>
      </sec>
      <sec>
        <title>3.3. cAMP Quantification</title>
        <sec>
          <title>3.3.1. Culture Conditions</title>
          <p>10<sup>6</sup> spores/mL were washed in GMM and suspended in 400 mL GMM in 1 L flasks, and grown at 37 °C at 300 r.p.m. for 18 h. At this time, mycelia were harvested by vacuum filtration, washed once with sterile GMM, and divided into 200 mg pieces which were inoculated into 20 mL fresh, sterile GMM in 50 mL conical tubes. These subcultures were equilibrated for 1 h at 37 °C at 300 r.p.m. </p>
          <p>Initially, different phenological stages of <italic>A. nidulans</italic> were compared for their response to 13(<italic>S</italic>)-HpODE: (<italic>i</italic>) 12-h and (<italic>ii</italic>) 18-h liquid shake cultures (cultured as described above), and (<italic>iii</italic>) tissues harvested from 18-h liquid shake cultures by filtration and asexually induced by spreading onto GMM agar and incubating for 4 h at 37 °C in constant light. Eighteen hours liquid shake cultures were the only ones in which 13(<italic>S</italic>)-HpODE treatment produced a significant change in cAMP concentrations (data not shown), so these conditions were used for all subsequent experiments. Depending on the experiment, three or four biological replicates were performed for each treatment. Each experiment was performed twice with similar results. </p>
        </sec>
        <sec>
          <title>3.3.2. Treatment</title>
          <p>After equilibration, cultures were treated with 12.5 μL of 5 mg/mL pure oxylipin (in EtOH) or with the same volume of pure EtOH as a control. Thus, oxylipins were at a final concentration of 10 μM. When other concentrations of oxylipins were needed, concentrated or diluted stocks were used so that the same volume, 12.5 μL (in EtOH), was always added to each sample. Samples were shaken by hand for precisely twenty seconds. Next, mycelia was separated from growth medium by filtration using Grade 1 Whatman filter paper (11 μM), scraped into microcentrifuge tubes, and flash-frozen in liquid nitrogen. Samples were stored for a maximum of 24 h at −80 °C until extraction and cAMP quantification.</p>
        </sec>
        <sec>
          <title>3.3.3. Extraction</title>
          <p>Frozen mycelia were ground to a fine powder with a clean, pre-chilled mortar and pestle in liquid nitrogen and weighed on a microbalance. Tissue was resuspended by vortexing in 50 mM Tris.HCl/4 mM EDTA (pH 7.5) followed by boiling for five minutes and subsequent acidification by addition of concentrated HCl to a final concentration of 0.1 M. Samples were then incubated for ten minutes on ice and centrifuged for five minutes at 13,000 r.p.m. at 4 °C. The supernatant was transferred to a fresh microcentrifuge tube and flash-frozen in liquid nitrogen. Acidified supernatants were split into two subsamples, one for quantification of cAMP and the other for quantification of protein. </p>
        </sec>
        <sec>
          <title>3.3.4. Quantification of cAMP</title>
          <p>cAMP was measured using the Direct cAMP colorimetric (EIA) kit (Enzo Life Sciences, Exeter, UK) according to the manufacturer’s directions. Reactions were performed in 96 well plates and optical density (OD<sub>405</sub>–OD<sub>595</sub>) was measured using a Victor<sup>3</sup> V multiwell plate reader (Perkin Elmer, Waltham, MA, USA). Corrected absorbance readings were fitted to a four-parameter sigmoidal model, and cAMP concentrations of unknowns from each plate were interpolated from that individual plate’s standard curve. The <italic>R</italic><sup>2</sup> for all plate-specific standard curves was always ≥0.99 except for the <italic>∆cyaA</italic> test plate, for which the <italic>R</italic><sup>2</sup> was 0.94. Two technical replications were performed on each sample.</p>
        </sec>
        <sec>
          <title>3.3.5. Protein Quantification</title>
          <p>Protein content was measured using the Bradford reagent supplied by BioRad (Hercules, CA, USA) according to the manufacturer’s directions. To neutralize the 0.1 M HCl in the samples to be used for protein quantification, an equal volume of 0.1 N NaOH was added to each subsample.</p>
        </sec>
      </sec>
      <sec>
        <title>3.4. Oxylipins and Fatty Acids</title>
        <p>13(<italic>S</italic>)-Hydroperoxy-<italic>cis</italic>-9,<italic>trans</italic>-11-octadecadienoic acid [13(<italic>S</italic>)-HpODE], 9(<italic>S</italic>)-hydroperoxy-<italic>trans</italic>-10,<italic>cis</italic>-12-octadecadienoicacid [9(<italic>S</italic>)-HpODE], 9(<italic>S</italic>)-hydroxy-<italic>trans</italic>-10,<italic>cis</italic>-12-octadecadienoic acid [9(<italic>S</italic>)-HODE], 13(<italic>S</italic>)-hydroxy-<italic>cis</italic>-9,<italic>trans</italic>-11-octadecadienoic acid [13(<italic>S</italic>)-HODE] and linoleic acid were purchased from Cayman Chemical (Ann Arbor, MI, USA).</p>
      </sec>
      <sec>
        <title>3.5. Density-Dependent Physiology</title>
        <p>Strains were grown and analyzed as described in Horowitz Brown <italic>et al</italic>. [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>]. Sixty millimeters diameter plates containing 10 mL GMM + 2% sorbitol (1.5% agar) were overlaid with 3 mL GMM + 2% sorbitol (0.75% agar) containing 10<sup>3</sup> or 10<sup>7</sup> spores. Eight replicates per set were placed in the dark at 29 °C for seven days. Four replicates were used for sclerotia quantification, and the other four replicates were used for enumeration of conidia and AF extraction. For sclerotia analysis, plates were sprayed with 70% ethanol to remove conidia, and sclerotia were scraped off with a spatula. The sclerotia were placed into pre-weighed microcentrifuge tubes, flash-frozen in liquid nitrogen, lyophilized, and weighed. Three 15-mm diameter cores were removed from each of the other four replicates and homogenized in 4.5 mL 0.01% Tween H<sub>2</sub>O. A 100-μL aliquot was removed from each tube, diluted, and the spores were counted on a hemacytometer. To extract AF, 3 mL of chloroform were added to each tube, the tubes were shaken vigorously and spun at 3000 r.p.m. for 10 min. The chloroform layer was removed, dried down, and resuspended in 100 μL chloroform. 10 μL was spotted onto a thin layer chromatography (TLC) plate alongside an AFB<sub>1</sub> standard, and the plates were placed in a TLC chamber containing 9:1 chloroform:acetone. After separation of metabolites, the plates were visualized at 366 nm, and the spot intensities were measured using Adobe Photoshop (version 11.0; Adobe Systems Incorporated: San Jose, California, USA, 2008). Absolute intensity was calculated by multiplying the mean pixel intensity by the number of pixels in the selected area encompassing an AF spot.</p>
      </sec>
      <sec>
        <title>3.6. Spent Media Bioassay</title>
        <sec>
          <title>3.6.1. Extract Collection</title>
          <p>Extracts from high-density and media-only plates were collected as described [<xref ref-type="bibr" rid="B16-toxins-04-00695">16</xref>]. Briefly, thirty 100-mm diameter plates containing 25 mL GMM + 2% sorbitol (1.5% agar) were overlaid with 10 mL GMM + 2% sorbitol (0.75% agar) containing 10<sup>7</sup><italic>A. flavus</italic> wild type (NRRL3357) spores. The same set-up was repeated with no spores added for a media-only control. All plates were incubated in the dark at 29 °C for five days. The plate contents were homogenized in a blender (ten plates plus 250 mL sterile distilled H<sub>2</sub>O a time) and transferred to a 4-L beaker. One volume of ethyl acetate was mixed in, and the macerate was allowed to settle overnight. The organic layer was removed, filtered through Whatman™ #1 filter paper and evaporated using a rotary evaporator. The final extract was resuspended in 2.5 mL ethanol, topped with nitrogen gas, and stored at −80 °C. </p>
        </sec>
        <sec>
          <title>3.6.2. Bioassay</title>
          <p>The extracts were diluted 1:10 in ethanol, and 100 μL of diluted extract was spread onto 60-mm diameter plates containing 10 mL GMM + 2% sorbitol (1.5% agar). Plates were allowed to dry for fifteen minutes and were then inoculated with 10<sup>6</sup> spores in 3 mL GMM + 2% sorbitol (0.75% agar). Four replicates per strain per treatment were prepared and placed in the dark at 29 °C for three days. Enumeration of conidia was carried out as described for density-dependent physiology tests.</p>
        </sec>
      </sec>
      <sec>
        <title>3.7. Linoleic Acid Disk Assay</title>
        <p>Sixty-millimeter diameter plates containing 10 mL GMM + 2% sorbitol (1.5% agar) were overlaid with 10<sup>5</sup> spores in 3 mL GMM + 2% sorbitol (0.75% agar). Linoleic acid in ethanol (1 mg per disk in a 15 μL volume) was applied to sterile 12.7 mm diameter filter disks. Control disks were prepared with 15 μL ethanol. Once the disks dried, one disk was applied to the center of each plate for a total of four replicates per treatment per strain. The plates were placed in the dark at 29 °C for six days. Following this incubation, a 14-mm core containing the filter disk was removed and discarded. A 22-mm core, with the removed portion directly centered, was punched out, and this ring was homogenized in 3 mL 0.01% Tween H<sub>2</sub>O. Spore enumeration continued from this point as previously described.</p>
      </sec>
      <sec>
        <title>3.8. Statistical Analysis</title>
        <p>In <xref ref-type="fig" rid="toxins-04-00695-f001">Figure 1</xref> and <xref ref-type="fig" rid="toxins-04-00695-f002">Figure 2</xref>, one-tailed paired Student’s <italic>T</italic>-tests were performed using the T.TEST function in Microsoft Excel in the Microsoft Office Professional Plus 2010 package. In <xref ref-type="fig" rid="toxins-04-00695-f001">Figure 1</xref>B, treatment means were compared using a Student’s <italic>T</italic>-tests following an analysis of variance (single-factor ANOVA; MS Excel). In <xref ref-type="fig" rid="toxins-04-00695-f003">Figure 3</xref>, ANOVA was performed with Prism 5<sup>®</sup> software using one-way ANOVA and Tukey’s multiple comparison post-test. In <xref ref-type="fig" rid="toxins-04-00695-f004">Figure 4</xref> and <xref ref-type="fig" rid="toxins-04-00695-f005">Figure 5</xref>, two-tailed unpaired Student’s <italic>T</italic>-tests were performed using the T.TEST function in Microsoft Excel in the Microsoft Office 2008 package.</p>
      </sec>
    </sec>
    <sec sec-type="conclusions">
      <title>4. Conclusions</title>
      <p>We found that GprD was essential for the induction of cAMP in <italic>A. nidulans</italic> in response to exogenous plant oxylipins. We also found that GprC and GprD in <italic>A. flavus</italic> were essential for the perception of a still-unknown signal found in high-density cultures that induces sclerotia formation while inhibiting AF and conidial formation. The finding of fungal receptors critical for <italic>A. flavus</italic> development and potentially receptive to seed signals is an exciting prospect for future study. Not only does the identity of such receptors deepen our knowledge of fungal biology but also carries great potential for combatting pathogenic fungi. Mammalian GPCRs are extensively studied for their therapeutic potential—approximately half of all drugs target GPCRs [<xref ref-type="bibr" rid="B54-toxins-04-00695">54</xref>], and so drugs that can block critical fungal GPCRs may serve as valuable anti-fungal treatments.</p>
    </sec>
    <sec>
      <title>Supplementary</title>
	  <fig id="toxins-04-00695-f007" position="anchor">
            <label>Figure S1</label>
            <caption>
              <p>Samples were treated with EtOH (control) or 10 μM 13(<italic>S</italic>)-HpODE in EtOH. Tissues were harvested as described, and cAMP concentrations were measured. Differences from the EtOH control are denoted as follows: <bold>*</bold><italic>p</italic> &lt; 0.05, determined by a one-tailed paired Student’s <italic>T</italic>-test.</p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g007.tif"/>
          </fig>
        <fig id="toxins-04-00695-f008" position="anchor">
            <label>Figure S2</label>
            <caption>
              <p>Amino acid sequences for <italic>A. nidulans</italic> GprD and <italic>A. flavus</italic> GprC and GprD were aligned using Clustal Omega [<xref ref-type="bibr" rid="B55-toxins-04-00695">55</xref>,<xref ref-type="bibr" rid="B56-toxins-04-00695">56</xref>] and Jalview [<xref ref-type="bibr" rid="B57-toxins-04-00695">57</xref>,<xref ref-type="bibr" rid="B58-toxins-04-00695">58</xref>] with Blosum62 coloring scheme. According to this scheme, gaps are colored white, matching residues are colored dark blue, and non-matching but positively scored residues are colored light blue.</p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g008.tif"/>
          </fig>
          <fig id="toxins-04-00695-f009" position="anchor">
            <label>Figure S3</label>
            <caption>
              <p>(<bold>a</bold>) The general scheme for deleting <italic>A. flavus gprC</italic> and <italic>gprD</italic> by replacing with <italic>pyrG</italic> is shown here. The light blue bar represents the region amplified for the Southern probe; (<bold>b</bold>) The plasmid used to deplete <italic>A. flavus gprC</italic> and <italic>gprD</italic> transcripts, pKJA27, is depicted here. The light blue bar represents the region amplified for the Southern probe; (<bold>c</bold>) The <italic>∆gprC::pyrG</italic> strain, TKJA10.1, was confirmed by Southern analysis. Genomic DNA was digested with <italic>Sac</italic>I (WT expected bands: 5.2 and 2.1 kb; <italic>∆gprC</italic> expected bands: 4.9, 2.1, and 1.1 kb) and <italic>Xho</italic>I (WT expected band: 5.2 kb; <italic>∆gprC</italic> expected bands: 3.8 and 2.1 kb); (<bold>d</bold>) The <italic>∆gprD::pyrG</italic> strain, TKJA8.1, was confirmed by Southern analysis. Genomic DNA was digested with <italic>Xho</italic>I (WT expected bands: 6.1 and 2.3 kb; <italic>∆gprD</italic> expected bands: 5.8, 2.3, and 1.1 kb) and <italic>Sph</italic>I (WT expected bands: 6.5, 6.1 (faint), and 1.3 kb; <italic>∆gprD</italic> expected bands: 8.6 and 6.1 (faint) kb); (<bold>e</bold>) The <italic>KD::gprCD</italic> strain, TKJA14.2, was confirmed by Southern analysis. The <italic>gpdA</italic> promoter is derived from <italic>A. nidulans</italic>, so the probe will only hybridize if pKJA27 is present. Genomic DNA was digested with <italic>Stu</italic>I (WT and parental strain 3357.5 (denoted “P”) should have no bands; transformants should have one band for each copy of the plasmid they integrated); (<bold>f</bold>) The <italic>KD::gprCD</italic> strain, TKJA14.2, was confirmed by Northern analysis. Probes within the coding regions of <italic>gprC</italic> and <italic>gprD</italic> were used, and correct transformants were identified by the smear of degraded transcripts, seen for transformants #14 and #15.</p>
            </caption>
            <graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="toxins-04-00695-g009.tif"/>
          </fig>
        
    </sec>
  </body>
  <back>
    <ack>
      <title>Acknowledgements</title>
      <p>We thank Jae-Hyuk Yu, Jae-Hyung Ma, and DaWoon Chung for construction and generous sharing of strains. This work was supported by NSF IOS-0965649 (N.P.K. and K.J.A.) and USDA-CSREES Microbial Biology program, award #2007-35319-18183 (M.B.). N.P.K. was also supported in part by NIH 1 R01 Al065728-0. We thank Kyle Fowler and Colin Lappala for characterization of the <italic>gprD</italic> transcripts in <italic>A. nidulans</italic> and <italic>A. flavus</italic>. </p>
    </ack>
	<notes>
      <title>Conflict of Interest</title>
      <p>The authors declare no conflict of interest. </p>
    </notes>
    <ref-list>
      <title>References</title>
      <ref id="B1-toxins-04-00695">
        <label>1.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Squire</surname>
              <given-names>R.A.</given-names>
            </name>
          </person-group>
          <article-title>Ranking animal carcinogens: A proposed regulatory approach</article-title>
          <source>Science</source>
          <year>1981</year>
          <volume>214</volume>
          <fpage>877</fpage>
          <lpage>880</lpage>
        <pub-id pub-id-type="doi">10.1126/science.7302565</pub-id><pub-id pub-id-type="pmid">7302565</pub-id></citation>
      </ref>
      <ref id="B2-toxins-04-00695">
        <label>2.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ozturk</surname>
              <given-names>M.</given-names>
            </name>
          </person-group>
          <article-title>p53 mutation in hepatocellular carcinoma after aflatoxin exposure</article-title>
          <source>Lancet</source>
          <year>1991</year>
          <volume>338</volume>
          <fpage>1356</fpage>
          <lpage>1359</lpage>
          <pub-id pub-id-type="doi">10.1016/0140-6736(91)92236-U</pub-id>
        </citation>
      </ref>
      <ref id="B3-toxins-04-00695">
        <label>3.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gouas</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Shi</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Hainaut</surname>
              <given-names>P.</given-names>
            </name>
          </person-group>
          <article-title>The aflatoxin-induced TP53 mutation at codon 249 (R249S): Biomarker of exposure, early detection and target for therapy</article-title>
          <source>Cancer Lett.</source>
          <year>2009</year>
          <volume>286</volume>
          <fpage>29</fpage>
          <lpage>37</lpage>
          <pub-id pub-id-type="doi">10.1016/j.canlet.2009.02.057</pub-id>
        </citation>
      </ref>
      <ref id="B4-toxins-04-00695">
        <label>4.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yu</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Cleveland</surname>
              <given-names>T.E.</given-names>
            </name>
            <name>
              <surname>Nierman</surname>
              <given-names>W.C.</given-names>
            </name>
            <name>
              <surname>Bennett</surname>
              <given-names>J.W.</given-names>
            </name>
          </person-group>
          <article-title><italic>Aspergillus flavus</italic> genomics: Gateway to human and animal health, food safety, and crop resistance to disease</article-title>
          <source>Rev. Iberoam. Micol.</source>
          <year>2005</year>
          <volume>22</volume>
          <fpage>194</fpage>
          <lpage>202</lpage>
          <pub-id pub-id-type="doi">10.1016/S1130-1406(05)70043-7</pub-id>
        </citation>
      </ref>
      <ref id="B5-toxins-04-00695">
        <label>5.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lewis</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Onsongo</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Njapau</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Schurz-Rogers</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Luber</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Kieszak</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Nyamongo</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Backer</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Dahiye</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Misore</surname>
              <given-names>A.</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Aflatoxin contamination of commercial maize products during an outbreak of acute aflatoxicosis in eastern and central Kenya</article-title>
          <source>Environ. Health Perspect.</source>
          <year>2005</year>
          <volume>113</volume>
          <fpage>1763</fpage>
          <lpage>1767</lpage>
        <pub-id pub-id-type="doi">10.1289/ehp.7998</pub-id><pub-id pub-id-type="pmid">16330360</pub-id></citation>
      </ref>
      <ref id="B6-toxins-04-00695">
        <label>6.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Boyce</surname>
              <given-names>J.A.</given-names>
            </name>
          </person-group>
          <article-title>Mast cells and eicosanoid mediators: A system of reciprocal paracrine and autocrine regulation</article-title>
          <source>Immunol. Rev.</source>
          <year>2007</year>
          <volume>217</volume>
          <fpage>168</fpage>
          <lpage>185</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1600-065X.2007.00512.x</pub-id>
        </citation>
      </ref>
      <ref id="B7-toxins-04-00695">
        <label>7.</label>
        <citation citation-type="book">
          <person-group person-group-type="author">
            <name>
              <surname>Affeldt</surname>
              <given-names>K.J.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Oxylipins in Fungal-Mammalian. Interactions</article-title>
          <source>Biocommunications of Fungi</source>
          <person-group person-group-type="editor">
            <name>
              <surname>Witzany</surname>
              <given-names>G.</given-names>
            </name>
          </person-group>
          <publisher-name>Springer</publisher-name>
          <publisher-loc>Houten, The Netherlands</publisher-loc>
          <year>2012</year>
          <fpage>291</fpage>
          <lpage>303</lpage>
        </citation>
      </ref>
      <ref id="B8-toxins-04-00695">
        <label>8.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Christensen</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Kolomiets</surname>
              <given-names>M.V.</given-names>
            </name>
          </person-group>
          <article-title>The lipid language of plant-fungal interactions</article-title>
          <source>Fungal Genet. Biol.</source>
          <year>2011</year>
          <volume>48</volume>
          <fpage>4</fpage>
          <lpage>14</lpage>
          <pub-id pub-id-type="doi">10.1016/j.fgb.2010.05.005</pub-id>
        </citation>
      </ref>
      <ref id="B9-toxins-04-00695">
        <label>9.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>León-Morcillo</surname>
              <given-names>R.J.</given-names>
            </name>
            <name>
              <surname>Angel</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Martín-Rodríguez</surname>
            </name>
            <name>
              <surname>Vierheilig</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Ocampo</surname>
              <given-names>J.A.</given-names>
            </name>
            <name>
              <surname>García-Garrido</surname>
              <given-names>J.M.</given-names>
            </name>
          </person-group>
          <article-title>Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling</article-title>
          <source>J. Exp. Bot.</source>
          <year>2012</year>
          <volume>63</volume>
          <fpage>3545</fpage>
          <lpage>3558</lpage>
          <pub-id pub-id-type="doi">10.1093/jxb/ers010</pub-id>
        </citation>
      </ref>
      <ref id="B10-toxins-04-00695">
        <label>10.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Kunze</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Willis</surname>
              <given-names>D.K.</given-names>
            </name>
            <name>
              <surname>Feussner</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title><italic>Aspergillus</italic> infection inhibits the expression of peanut 13<italic>S</italic>-HPODE-forming seed lipoxygenases</article-title>
          <source>Mol. Plant Microbe Interact</source>
          <year>2005</year>
          <volume>18</volume>
          <fpage>1081</fpage>
          <lpage>1089</lpage>
          <pub-id pub-id-type="doi">10.1094/MPMI-18-1081</pub-id>
        </citation>
      </ref>
      <ref id="B11-toxins-04-00695">
        <label>11.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Oxylipins act as determinants of natural product biosynthesis and seed colonization in <italic>Aspergillus nidulans</italic></article-title>
          <source>Mol. Microbiol.</source>
          <year>2006</year>
          <volume>59</volume>
          <fpage>882</fpage>
          <lpage>892</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1365-2958.2005.05000.x</pub-id>
        </citation>
      </ref>
      <ref id="B12-toxins-04-00695">
        <label>12.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Brodhagen</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Hornung</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Goebel</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Feussner</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Reciprocal oxylipin-mediated cross-talk in the <italic>Aspergillus</italic>-seed pathosystem</article-title>
          <source>Mol. Microbiol.</source>
          <year>2008</year>
          <volume>67</volume>
          <fpage>378</fpage>
          <lpage>391</lpage>
        <pub-id pub-id-type="pmid">18181962</pub-id></citation>
      </ref>
      <ref id="B13-toxins-04-00695">
        <label>13.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gao</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Brodhagen</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Isakeit</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>S.H.</given-names>
            </name>
            <name>
              <surname>Göbel</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Betran</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Feussner</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
            <name>
              <surname>Kolomiets</surname>
              <given-names>M.V.</given-names>
            </name>
          </person-group>
          <article-title>Inactivation of the lipoxygenase ZmLOX3 increases susceptibility of maize to <italic>Aspergillus</italic> spp</article-title>
          <source>Mol. Plant-Microbe Interact</source>
          <year>2009</year>
          <volume>22</volume>
          <fpage>222</fpage>
          <lpage>231</lpage>
          <pub-id pub-id-type="doi">10.1094/MPMI-22-2-0222</pub-id>
        </citation>
      </ref>
      <ref id="B14-toxins-04-00695">
        <label>14.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jensen</surname>
              <given-names>E.C.</given-names>
            </name>
            <name>
              <surname>Ogg</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Nickerson</surname>
              <given-names>K.W.</given-names>
            </name>
          </person-group>
          <article-title>Lipoxygenase inhibitors shift the yeast/mycelium dimorphism in <italic>Ceratocystis ulmi</italic></article-title>
          <source>Appl. Environ. Microbiol.</source>
          <year>1992</year>
          <volume>58</volume>
          <fpage>2505</fpage>
          <lpage>2508</lpage>
        <pub-id pub-id-type="pmid">1514797</pub-id></citation>
      </ref>
      <ref id="B15-toxins-04-00695">
        <label>15.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Oxylipins as developmental and host-fungal communication signals</article-title>
          <source>Trends Microbiol.</source>
          <year>2007</year>
          <volume>15</volume>
          <fpage>109</fpage>
          <lpage>118</lpage>
          <pub-id pub-id-type="doi">10.1016/j.tim.2007.01.005</pub-id>
        </citation>
      </ref>
      <ref id="B16-toxins-04-00695">
        <label>16.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Horowitz Brown</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Zarnowski</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Sharpee</surname>
              <given-names>W.C.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Morphological transitions governed by density dependence and lipoxygenase activity in <italic>Aspergillus flavus</italic></article-title>
          <source>Appl. Environ. Microbiol.</source>
          <year>2008</year>
          <volume>74</volume>
          <fpage>5674</fpage>
          <lpage>5685</lpage>
          <pub-id pub-id-type="doi">10.1128/AEM.00565-08</pub-id>
        </citation>
      </ref>
      <ref id="B17-toxins-04-00695">
        <label>17.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Brown</surname>
              <given-names>S.H.</given-names>
            </name>
            <name>
              <surname>Scott</surname>
              <given-names>J.B.</given-names>
            </name>
            <name>
              <surname>Bhaheetharan</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Sharpee</surname>
              <given-names>W.C.</given-names>
            </name>
            <name>
              <surname>Milde</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Wilson</surname>
              <given-names>R.A.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Oxygenase coordination is required for morphological transition and the host-fungus interaction of <italic>Aspergillus flavus</italic></article-title>
          <source>Mol. Plant-Microbe Interact</source>
          <year>2009</year>
          <volume>22</volume>
          <fpage>882</fpage>
          <lpage>894</lpage>
          <pub-id pub-id-type="doi">10.1094/MPMI-22-7-0882</pub-id>
        </citation>
      </ref>
      <ref id="B18-toxins-04-00695">
        <label>18.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Brodhun</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Feussner</surname>
              <given-names>I.</given-names>
            </name>
          </person-group>
          <article-title>Oxylipins in fungi</article-title>
          <source>FEBS J.</source>
          <year>2011</year>
          <volume>278</volume>
          <fpage>1047</fpage>
          <lpage>1063</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1742-4658.2011.08027.x</pub-id>
        </citation>
      </ref>
      <ref id="B19-toxins-04-00695">
        <label>19.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Zarnowski</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>The lipid body protein, PpoA, coordinates sexual and asexual sporulation in <italic>Aspergillus nidulan</italic></article-title>
          <source>J. Biol. Chem.</source>
          <year>2004</year>
          <volume>279</volume>
          <fpage>11344</fpage>
          <lpage>11353</lpage>
        <pub-id pub-id-type="doi">10.1074/jbc.M310840200</pub-id><pub-id pub-id-type="pmid">14699095</pub-id></citation>
      </ref>
      <ref id="B20-toxins-04-00695">
        <label>20.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Kowieski</surname>
              <given-names>T.M.</given-names>
            </name>
            <name>
              <surname>Zarnowski</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Endogenous lipogenic regulators of spore balance in <italic>Aspergillus nidulans</italic></article-title>
          <source>Euk. Cell</source>
          <year>2004</year>
          <volume>3</volume>
          <fpage>1398</fpage>
          <lpage>1411</lpage>
          <pub-id pub-id-type="doi">10.1128/EC.3.6.1398-1411.2004</pub-id>
        </citation>
      </ref>
      <ref id="B21-toxins-04-00695">
        <label>21.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Kowieski</surname>
              <given-names>T.M.</given-names>
            </name>
            <name>
              <surname>Zarnowski</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Three putative oxylipin biosynthetic genes integrate sexual and asexual development in <italic>Aspergillus nidulans</italic></article-title>
          <source>Microbiology</source>
          <year>2005</year>
          <volume>151</volume>
          <fpage>1809</fpage>
          <lpage>1821</lpage>
          <pub-id pub-id-type="doi">10.1099/mic.0.27880-0</pub-id>
        </citation>
      </ref>
      <ref id="B22-toxins-04-00695">
        <label>22.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tsitsigiannis</surname>
              <given-names>D.I.</given-names>
            </name>
            <name>
              <surname>Bok</surname>
              <given-names>J.-W.</given-names>
            </name>
            <name>
              <surname>Andes</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Nielsen</surname>
              <given-names>K.F.</given-names>
            </name>
            <name>
              <surname>Frisvad</surname>
              <given-names>J.C.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title><italic>Aspergillus</italic> cyclooxygenase-like enzymes are associated with prostaglandin production and virulence</article-title>
          <source>Infect. Immun.</source>
          <year>2005</year>
          <volume>73</volume>
          <fpage>4548</fpage>
          <lpage>4559</lpage>
          <pub-id pub-id-type="doi">10.1128/IAI.73.8.4548-4559.2005</pub-id>
        </citation>
      </ref>
      <ref id="B23-toxins-04-00695">
        <label>23.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dagenais</surname>
              <given-names>T.R.T.</given-names>
            </name>
            <name>
              <surname>Chung</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Giles</surname>
              <given-names>S.S.</given-names>
            </name>
            <name>
              <surname>Hull</surname>
              <given-names>C.M.</given-names>
            </name>
            <name>
              <surname>Andes</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Defects in conidiophore development and conidium-macrophage interactions in a dioxygenase mutant of <italic>Aspergillus fumigatus</italic></article-title>
          <source>Infect. Immun.</source>
          <year>2008</year>
          <volume>76</volume>
          <fpage>3214</fpage>
          <lpage>3220</lpage>
          <pub-id pub-id-type="doi">10.1128/IAI.00009-08</pub-id>
        </citation>
      </ref>
      <ref id="B24-toxins-04-00695">
        <label>24.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Jarosz</surname>
              <given-names>L.M.</given-names>
            </name>
            <name>
              <surname>Ovchinnikova</surname>
              <given-names>E.S.</given-names>
            </name>
            <name>
              <surname>Meijler</surname>
              <given-names>M.M.</given-names>
            </name>
            <name>
              <surname>Krom</surname>
              <given-names>B.P.</given-names>
            </name>
          </person-group>
          <article-title>Microbial spy games and host response: Roles of a <italic>Pseudomonas aeruginosa</italic> small molecule in communication with other species</article-title>
          <source>PLoS Pathog.</source>
          <year>2011</year>
          <volume>7</volume>
          <fpage>e1002312</fpage>
          <pub-id pub-id-type="doi">10.1371/journal.ppat.1002312</pub-id>
        </citation>
      </ref>
      <ref id="B25-toxins-04-00695">
        <label>25.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Albuquerque</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Casadevall</surname>
              <given-names>A.</given-names>
            </name>
          </person-group>
          <article-title>Quorum sensing in fungi—A review</article-title>
          <source>Med. Mycol.</source>
          <year>2012</year>
          <volume>50</volume>
          <fpage>337</fpage>
          <lpage>345</lpage>
        <pub-id pub-id-type="doi">10.3109/13693786.2011.652201</pub-id><pub-id pub-id-type="pmid">22268493</pub-id></citation>
      </ref>
      <ref id="B26-toxins-04-00695">
        <label>26.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Singh</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>del Poeta</surname>
              <given-names>M.</given-names>
            </name>
          </person-group>
          <article-title>Lipid signalling in pathogenic fungi</article-title>
          <source>Cell. Microbiol.</source>
          <year>2011</year>
          <volume>13</volume>
          <fpage>177</fpage>
          <lpage>185</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1462-5822.2010.01550.x</pub-id>
        </citation>
      </ref>
      <ref id="B27-toxins-04-00695">
        <label>27.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Herrero-Garcia</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Garzia</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Cordobés</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Espeso</surname>
              <given-names>E.A.</given-names>
            </name>
            <name>
              <surname>Ugalde</surname>
              <given-names>U.</given-names>
            </name>
          </person-group>
          <article-title>8-Carbon oxylipins inhibit germination and growth, and stimulate aerial conidiation in <italic>Aspergillus nidulans</italic></article-title>
          <source>Fungal Biol.</source>
          <year>2011</year>
          <volume>115</volume>
          <fpage>393</fpage>
          <lpage>400</lpage>
          <pub-id pub-id-type="doi">10.1016/j.funbio.2011.02.005</pub-id>
        </citation>
      </ref>
      <ref id="B28-toxins-04-00695">
        <label>28.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Burow</surname>
              <given-names>G.B.</given-names>
            </name>
            <name>
              <surname>Nesbitt</surname>
              <given-names>T.C.</given-names>
            </name>
            <name>
              <surname>Dunlap</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Seed lipoxygenase products modulate <italic>Aspergillus</italic> mycotoxin biosynthesis</article-title>
          <source>Mol. Plant Microbe Interact.</source>
          <year>1997</year>
          <volume>10</volume>
          <fpage>380</fpage>
          <lpage>387</lpage>
          <pub-id pub-id-type="doi">10.1094/MPMI.1997.10.3.380</pub-id>
        </citation>
      </ref>
      <ref id="B29-toxins-04-00695">
        <label>29.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Calvo</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Hinze</surname>
              <given-names>L.L.</given-names>
            </name>
            <name>
              <surname>Gardner</surname>
              <given-names>H.W.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Sporogenic effect of polyunsaturated fatty acids on development of <italic>Aspergillus</italic> spp</article-title>
          <source>Appl. Environ. Microbiol.</source>
          <year>1999</year>
          <volume>65</volume>
          <fpage>3668</fpage>
          <lpage>3673</lpage>
        <pub-id pub-id-type="pmid">10427064</pub-id></citation>
      </ref>
      <ref id="B30-toxins-04-00695">
        <label>30.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ricciotti</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Fitzgerald</surname>
              <given-names>G.A.</given-names>
            </name>
          </person-group>
          <article-title>Prostaglandins and inflammation</article-title>
          <source>Arterioscler. Thromb. Vasc. Biol.</source>
          <year>2011</year>
          <volume>31</volume>
          <fpage>986</fpage>
          <lpage>1000</lpage>
          <pub-id pub-id-type="doi">10.1161/ATVBAHA.110.207449</pub-id>
        </citation>
      </ref>
      <ref id="B31-toxins-04-00695">
        <label>31.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Singh</surname>
              <given-names>R.K.</given-names>
            </name>
            <name>
              <surname>Gupta</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Dastidar</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Ray</surname>
              <given-names>A.</given-names>
            </name>
          </person-group>
          <article-title>Cysteinyl leukotrienes and their receptors: Molecular and functional characteristics</article-title>
          <source>Pharmacology</source>
          <year>2010</year>
          <volume>85</volume>
          <fpage>336</fpage>
          <lpage>349</lpage>
          <pub-id pub-id-type="doi">10.1159/000312669</pub-id>
        </citation>
      </ref>
      <ref id="B32-toxins-04-00695">
        <label>32.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Folcik</surname>
              <given-names>V.A.</given-names>
            </name>
            <name>
              <surname>Cathcart</surname>
              <given-names>M.K.</given-names>
            </name>
          </person-group>
          <article-title>Predominance of esterified hydroperoxy-linoleic acid in human monocyte-oxidized LDL</article-title>
          <source>J. Lipid Res.</source>
          <year>1994</year>
          <volume>35</volume>
          <fpage>1570</fpage>
          <lpage>1582</lpage>
        <pub-id pub-id-type="pmid">7806971</pub-id></citation>
      </ref>
      <ref id="B33-toxins-04-00695">
        <label>33.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kühn</surname>
              <given-names>H.</given-names>
            </name>
          </person-group>
          <article-title>Biosynthesis, metabolization and biological importance of the primary 15-lipoxygenase metabolites 15-hydro(pero)xy-5Z,8Z,11Z,13E-eicosatetraenoic acid and 13-hydro(pero)xy-9Z,11E-octadecadienoic acid</article-title>
          <source>Prog. Lipid Res.</source>
          <year>1996</year>
          <volume>35</volume>
          <fpage>203</fpage>
          <lpage>226</lpage>
          <pub-id pub-id-type="doi">10.1016/S0163-7827(96)00008-2</pub-id>
        </citation>
      </ref>
      <ref id="B34-toxins-04-00695">
        <label>34.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hattori</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Obinata</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Ogawa</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Kishi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Tatei</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Ishikawa</surname>
              <given-names>O.</given-names>
            </name>
            <name>
              <surname>Izumi</surname>
              <given-names>T.</given-names>
            </name>
          </person-group>
          <article-title>G2A plays proinflammatory roles in human keratinocytes under oxidative stress as a receptor for 9-hydroxyoctadecadienoic acid</article-title>
          <source>J. Invest. Dermatol.</source>
          <year>2007</year>
          <volume>128</volume>
          <fpage>1123</fpage>
          <lpage>1133</lpage>
        <pub-id pub-id-type="pmid">18034171</pub-id></citation>
      </ref>
      <ref id="B35-toxins-04-00695">
        <label>35.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Obinata</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Hattori</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Nakane</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Tatei</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Izumi</surname>
              <given-names>T.</given-names>
            </name>
          </person-group>
          <article-title>Identification of 9-hydroxyoctadecadienoic acid and other oxidized free fatty acids as ligands of the G protein-coupled receptor G2A</article-title>
          <source>J. Biol. Chem.</source>
          <year>2005</year>
          <volume>280</volume>
          <fpage>40676</fpage>
          <lpage>40683</lpage>
        <pub-id pub-id-type="doi">10.1074/jbc.M507787200</pub-id><pub-id pub-id-type="pmid">16236715</pub-id></citation>
      </ref>
      <ref id="B36-toxins-04-00695">
        <label>36.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Obinata</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Izumi</surname>
              <given-names>T.</given-names>
            </name>
          </person-group>
          <article-title>G2A as a receptor for oxidized free fatty acids</article-title>
          <source>Prostaglandins Other Lipid Mediat.</source>
          <year>2009</year>
          <volume>89</volume>
          <fpage>66</fpage>
          <lpage>72</lpage>
          <pub-id pub-id-type="doi">10.1016/j.prostaglandins.2008.11.002</pub-id>
        </citation>
      </ref>
      <ref id="B37-toxins-04-00695">
        <label>37.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kulkarni</surname>
              <given-names>R.D.</given-names>
            </name>
            <name>
              <surname>Thon</surname>
              <given-names>M.R.</given-names>
            </name>
            <name>
              <surname>Pan</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Dean</surname>
              <given-names>R.A.</given-names>
            </name>
          </person-group>
          <article-title>Novel G-protein-coupled receptor-like proteins in the plant pathogenic fungus <italic>Magnaporthe</italic> <italic>grisea</italic></article-title>
          <source>Genome Biol.</source>
          <year>2005</year>
          <volume>6</volume>
          <fpage>R24</fpage>
          <pub-id pub-id-type="doi">10.1186/gb-2005-6-3-r24</pub-id>
        </citation>
      </ref>
      <ref id="B38-toxins-04-00695">
        <label>38.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lafon</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Han</surname>
              <given-names>K.-H.</given-names>
            </name>
            <name>
              <surname>Seo</surname>
              <given-names>J.-A.</given-names>
            </name>
            <name>
              <surname>Yu</surname>
              <given-names>J.-H.</given-names>
            </name>
            <name>
              <surname>d’Enfert</surname>
              <given-names>C.</given-names>
            </name>
          </person-group>
          <article-title>G-protein and cAMP-mediated signaling in aspergilli: A genomic perspective</article-title>
          <source>Fungal Genet. Biol.</source>
          <year>2006</year>
          <volume>43</volume>
          <fpage>490</fpage>
          <lpage>502</lpage>
          <pub-id pub-id-type="doi">10.1016/j.fgb.2006.02.001</pub-id>
        </citation>
      </ref>
      <ref id="B39-toxins-04-00695">
        <label>39.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zheng</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Dou</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Han</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Cai</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zhan</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Tang</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>Q.</given-names>
            </name>
          </person-group>
          <article-title>Genome-wide prediction of G protein-coupled receptors in <italic>Verticillium</italic> spp</article-title>
          <source>Fungal Biol</source>
          <year>2010</year>
          <volume>114</volume>
          <fpage>359</fpage>
          <lpage>368</lpage>
          <pub-id pub-id-type="doi">10.1016/j.funbio.2010.02.008</pub-id>
        </citation>
      </ref>
      <ref id="B40-toxins-04-00695">
        <label>40.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Wright</surname>
              <given-names>S.J.</given-names>
            </name>
            <name>
              <surname>Krystofova</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Park</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Borkovich</surname>
              <given-names>K.A.</given-names>
            </name>
          </person-group>
          <article-title>Heterotrimeric G protein signaling in filamentous fungi</article-title>
          <source>Annu. Rev. Microbiol.</source>
          <year>2007</year>
          <volume>61</volume>
          <fpage>423</fpage>
          <lpage>452</lpage>
          <pub-id pub-id-type="doi">10.1146/annurev.micro.61.080706.093432</pub-id>
        </citation>
      </ref>
      <ref id="B41-toxins-04-00695">
        <label>41.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Xue</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Hsueh</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Heitman</surname>
              <given-names>J.</given-names>
            </name>
          </person-group>
          <article-title>Magnificent seven: Roles of G protein-coupled receptors in extracellular sensing in fungi</article-title>
          <source>FEMS Microbiol. Rev.</source>
          <year>2008</year>
          <volume>32</volume>
          <fpage>1010</fpage>
          <lpage>1032</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1574-6976.2008.00131.x</pub-id>
        </citation>
      </ref>
      <ref id="B42-toxins-04-00695">
        <label>42.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shimizu</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Genetic involvement of a cAMP-dependent protein kinase in a G protein signaling pathway regulating morphological and chemical transitions in <italic>Aspergillus nidulans</italic></article-title>
          <source>Genetics</source>
          <year>2001</year>
          <volume>157</volume>
          <fpage>591</fpage>
          <lpage>600</lpage>
        <pub-id pub-id-type="pmid">11156981</pub-id></citation>
      </ref>
      <ref id="B43-toxins-04-00695">
        <label>43.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shimizu</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Hicks</surname>
              <given-names>J.K.</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>T.-P.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
          </person-group>
          <article-title>Pka, Ras and RGS protein interactions regulate activity of AflR, a Zn(II)2Cys6 transcription factor in <italic>Aspergillus nidulan</italic></article-title>
          <source>Genetics</source>
          <year>2003</year>
          <volume>165</volume>
          <fpage>1095</fpage>
          <lpage>1104</lpage>
        <pub-id pub-id-type="pmid">14668367</pub-id></citation>
      </ref>
      <ref id="B44-toxins-04-00695">
        <label>44.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fillinger</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Chaveroche</surname>
              <given-names>M.-K.</given-names>
            </name>
            <name>
              <surname>Shimizu</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>d’Enfert</surname>
              <given-names>C.</given-names>
            </name>
          </person-group>
          <article-title>cAMP and ras signalling independently control spore germination in the filamentous fungus <italic>Aspergillus nidulans</italic></article-title>
          <source>Mol. Microbiol.</source>
          <year>2002</year>
          <volume>44</volume>
          <fpage>1001</fpage>
          <lpage>1016</lpage>
          <pub-id pub-id-type="doi">10.1046/j.1365-2958.2002.02933.x</pub-id>
        </citation>
      </ref>
      <ref id="B45-toxins-04-00695">
        <label>45.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Roze</surname>
              <given-names>L.V.</given-names>
            </name>
            <name>
              <surname>Beaudry</surname>
              <given-names>R.M.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
            <name>
              <surname>Linz</surname>
              <given-names>J.E.</given-names>
            </name>
          </person-group>
          <article-title>Regulation of aflatoxin synthesis by FadA/cAMP/protein kinase A signaling in <italic>Aspergillus parasiticus</italic></article-title>
          <source>Mycopathologia</source>
          <year>2004</year>
          <volume>158</volume>
          <fpage>219</fpage>
          <lpage>232</lpage>
          <pub-id pub-id-type="doi">10.1023/B:MYCO.0000041841.71648.6e</pub-id>
        </citation>
      </ref>
      <ref id="B46-toxins-04-00695">
        <label>46.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lafon</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Seo</surname>
              <given-names>J.-A.</given-names>
            </name>
            <name>
              <surname>Han</surname>
              <given-names>K.-H.</given-names>
            </name>
            <name>
              <surname>Yu</surname>
              <given-names>J.-H.</given-names>
            </name>
            <name>
              <surname>d’Enfert</surname>
              <given-names>C.</given-names>
            </name>
          </person-group>
          <article-title>The heterotrimeric G-protein GanB(α)-SfaD(β)-GpgA(γ) is a carbon source sensor involved in early cAMP-dependent germination in <italic>Aspergillus nidulans</italic></article-title>
          <source>Genetics</source>
          <year>2005</year>
          <volume>171</volume>
          <fpage>71</fpage>
          <lpage>80</lpage>
          <pub-id pub-id-type="doi">10.1534/genetics.105.040584</pub-id>
        </citation>
      </ref>
      <ref id="B47-toxins-04-00695">
        <label>47.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liavonchanka</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Feussner</surname>
              <given-names>I.</given-names>
            </name>
          </person-group>
          <article-title>Lipoxygenases: Occurrence, functions and catalysis</article-title>
          <source>J. Plant Physiol.</source>
          <year>2006</year>
          <volume>163</volume>
          <fpage>348</fpage>
          <lpage>357</lpage>
          <pub-id pub-id-type="doi">10.1016/j.jplph.2005.11.006</pub-id>
        </citation>
      </ref>
      <ref id="B48-toxins-04-00695">
        <label>48.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ivanov</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Heydeck</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Hofheinz</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Roffeis</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>O’Donnell</surname>
              <given-names>V.B.</given-names>
            </name>
            <name>
              <surname>Kuhn</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Walther</surname>
              <given-names>M.</given-names>
            </name>
          </person-group>
          <article-title>Molecular enzymology of lipoxygenases</article-title>
          <source>Arch. Biochem. Biophys.</source>
          <year>2010</year>
          <volume>503</volume>
          <fpage>161</fpage>
          <lpage>174</lpage>
          <pub-id pub-id-type="doi">10.1016/j.abb.2010.08.016</pub-id>
        </citation>
      </ref>
      <ref id="B49-toxins-04-00695">
        <label>49.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Seo</surname>
              <given-names>J.-A.</given-names>
            </name>
            <name>
              <surname>Han</surname>
              <given-names>K.-H.</given-names>
            </name>
            <name>
              <surname>Yu</surname>
              <given-names>J.-H.</given-names>
            </name>
          </person-group>
          <article-title>The <italic>gprA</italic> and <italic>gprB</italic> genes encode putative G protein-coupled receptors required for self-fertilization in <italic>Aspergillus nidulans</italic></article-title>
          <source>Mol. Microbiol.</source>
          <year>2004</year>
          <volume>53</volume>
          <fpage>1611</fpage>
          <lpage>1623</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1365-2958.2004.04232.x</pub-id>
        </citation>
      </ref>
      <ref id="B50-toxins-04-00695">
        <label>50.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Han</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Seo</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Yu</surname>
              <given-names>J.</given-names>
            </name>
          </person-group>
          <article-title>A putative G protein-coupled receptor negatively controls sexual development in <italic>Aspergillus nidulans</italic></article-title>
          <source>Mol. Microbiol.</source>
          <year>2004</year>
          <volume>51</volume>
          <fpage>1333</fpage>
          <lpage>1345</lpage>
          <pub-id pub-id-type="doi">10.1111/j.1365-2958.2003.03940.x</pub-id>
        </citation>
      </ref>
      <ref id="B51-toxins-04-00695">
        <label>51.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>He</surname>
              <given-names>Z.-M.</given-names>
            </name>
            <name>
              <surname>Price</surname>
              <given-names>M.S.</given-names>
            </name>
            <name>
              <surname>Obrian</surname>
              <given-names>G.R.</given-names>
            </name>
            <name>
              <surname>Georgianna</surname>
              <given-names>D.R.</given-names>
            </name>
            <name>
              <surname>Payne</surname>
              <given-names>G.A.</given-names>
            </name>
          </person-group>
          <article-title>Improved protocols for functional analysis in the pathogenic fungus <italic>Aspergillus flavus</italic></article-title>
          <source>BMC Microbiol</source>
          <year>2007</year>
          <volume>7</volume>
        </citation>
      </ref>
      <ref id="B52-toxins-04-00695">
        <label>52.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>McDonald</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Brown</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>N.P.</given-names>
            </name>
            <name>
              <surname>Hammond</surname>
              <given-names>T.M.</given-names>
            </name>
          </person-group>
          <article-title>RNA silencing of mycotoxin production in <italic>Aspergillus</italic> and <italic>Fusarium</italic> species</article-title>
          <source>Mol. Plant Microbe Interact</source>
          <year>2005</year>
          <volume>18</volume>
          <fpage>539</fpage>
          <lpage>545</lpage>
          <pub-id pub-id-type="doi">10.1094/MPMI-18-0539</pub-id>
        </citation>
      </ref>
      <ref id="B53-toxins-04-00695">
        <label>53.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Szewczyk</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Nayak</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Oakley</surname>
              <given-names>C.E.</given-names>
            </name>
            <name>
              <surname>Edgerton</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Xiong</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Taheri-Talesh</surname>
              <given-names>N.</given-names>
            </name>
            <name>
              <surname>Osmani</surname>
              <given-names>S.A.</given-names>
            </name>
            <name>
              <surname>Oakley</surname>
              <given-names>B.R.</given-names>
            </name>
            <name>
              <surname>Oakley</surname>
              <given-names>B.</given-names>
            </name>
          </person-group>
          <article-title>Fusion PCR and gene targeting in <italic>Aspergillus nidulans</italic></article-title>
          <source>Nat. Protoc.</source>
          <year>2006</year>
          <volume>1</volume>
          <fpage>3111</fpage>
          <lpage>3120</lpage>
        <pub-id pub-id-type="pmid">17406574</pub-id></citation>
      </ref>
      <ref id="B54-toxins-04-00695">
        <label>54.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Drews</surname>
              <given-names>J.</given-names>
            </name>
          </person-group>
          <article-title>Drug discovery: A historical perspective</article-title>
          <source>Science</source>
          <year>2000</year>
          <volume>287</volume>
          <fpage>1960</fpage>
          <lpage>1964</lpage>
          <pub-id pub-id-type="doi">10.1126/science.287.5460.1960</pub-id>
        </citation>
      </ref>
      <ref id="B55-toxins-04-00695">
        <label>55.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Goujon</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>McWilliam</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Valentin</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Squizzato</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Paern</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Lopez</surname>
              <given-names>R.</given-names>
            </name>
          </person-group>
          <article-title>A new bioinformatics analysis tools framework at EMBL-EBI</article-title>
          <source>Nucleic Acids Res.</source>
          <year>2010</year>
          <volume>38</volume>
          <fpage>W695</fpage>
          <lpage>W699</lpage>
          <pub-id pub-id-type="doi">10.1093/nar/gkq313</pub-id>
        </citation>
      </ref>
      <ref id="B56-toxins-04-00695">
        <label>56.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sievers</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Wilm</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Dineen</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Gibson</surname>
              <given-names>T.J.</given-names>
            </name>
            <name>
              <surname>Karplus</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>W.</given-names>
            </name>
            <name>
              <surname>Lopez</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>McWilliam</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Remmert</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Söding</surname>
              <given-names>J.</given-names>
            </name>
            <etal/>
          </person-group>
          <article-title>Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega</article-title>
          <source>Mol. Syst. Biol.</source>
          <year>2011</year>
          <volume>7</volume>
        </citation>
      </ref>
      <ref id="B57-toxins-04-00695">
        <label>57.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Clamp</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Cuff</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Searle</surname>
              <given-names>S.M.</given-names>
            </name>
            <name>
              <surname>Barton</surname>
              <given-names>G.J.</given-names>
            </name>
          </person-group>
          <article-title>The Jalview Java alignment editor</article-title>
          <source>Bioinformatics</source>
          <year>2004</year>
          <volume>20</volume>
          <fpage>426</fpage>
          <lpage>427</lpage>
          <pub-id pub-id-type="doi">10.1093/bioinformatics/btg430</pub-id>
        </citation>
      </ref>
      <ref id="B58-toxins-04-00695">
        <label>58.</label>
        <citation citation-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Waterhouse</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Procter</surname>
              <given-names>J.B.</given-names>
            </name>
            <name>
              <surname>Martin</surname>
              <given-names>D.M.A.</given-names>
            </name>
            <name>
              <surname>Clamp</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Barton</surname>
              <given-names>G.J.</given-names>
            </name>
          </person-group>
          <article-title>Jalview Version 2—A multiple sequence alignment editor and analysis workbench</article-title>
          <source>Bioinformatics</source>
          <year>2009</year>
          <volume>25</volume>
          <fpage>1189</fpage>
          <lpage>1191</lpage>
          <pub-id pub-id-type="doi">10.1093/bioinformatics/btp033</pub-id>
        </citation>
      </ref>
    </ref-list>
  </back>
</article>
