E. coli strain MG1655 was lysogenized with λ^imm434hex− and the amount of phage produced spontaneously by E. coli strain MG1655 separated lysogenized with λ^imm434 and λ^imm434hex− was determined as described in the Experimental Section. We find that the MG1655::λ^imm434hex− lysogens produced 30-fold more phage during a five hour incubation then did the wild type (MG1655::λ^imm434) lysogens (Figure 4). This finding suggests that Hex may function in regulating the lysis-lysogeny of integrated λ^imm434 prophage. Alternatively, the increased in number of phage produced during the incubation may be a result of an effect of hex on the number of phage released/cell. We tested this idea by measuring phage burst sizes for both of these bacteriophages (see Experimental Section). We find that the burst sizes of the λ^imm434 and λ^imm434hex− phages are indistinguishable from each other; under the conditions of our measurements, each cell infected by these phages produces 104 phage.

Since RecA affects the level of spontaneous phage induction in a RecA⁺ host [15], we tested the idea that Hex may affect spontaneous induction by influencing RecA’s co-protease anti-repressor activity. To test this idea, we compared the spontaneous induction frequency of λ^imm434 and λ^imm434hex− prophages in wild type and RecA⁻ MG1655 strains. The spontaneous induction frequency of MG1655recA938::cat (λ^imm434hex−) is 1.8 ± 0.08 × 10⁻⁵, which is nearly identical to the spontaneous induction rate of MG1655recA938::cat::(λ^imm434) (Table 1). In contrast, the spontaneous induction frequency of λ^imm434hex− and λ^imm434 in wild type MG1655 are remarkably different. In the wild type host, the amount of induction of MG1655(λ^imm434hex−) is nearly 30-fold higher than the induction frequency of MG1655(λ^imm434) (Table 1) Although the frequency of spontaneous induction in a RecA⁻ host is much lower than in the wild type MG1655 host, the nearly identical frequency of induction in RecA⁻ host of both λ^imm434hex− and wild type λ^imm434 suggests that Hex increases the stability of λ^imm434 by interfering with RecA mediated autocleavage of the cI repressor.

We placed the hex gene under control of the T7 RNA polymerase promoter and attempted to express this full length gene product. We repeatedly observed that upon induction of Hex expression, cultures bearing plasmids encoding full-length Hex stopped growing, and subsequently showed a decrease in optical density at 600 nm. Therefore we initially attempted to purify Hex as a fusion with maltose binding protein (MBP). We reasoned that as a fusion with MBP (Maltose Binding Protein), the Hex peptide may be less detrimental to cell viability. When a plasmid encoding a MBP-Hex fusion protein was transformed into E. coli strain BL21(DE3)[pLysS], over-expression of the MBP-Hex protein was induced upon addition of IPTG. The expressed peptide was purified on an amylose resin and fractions containing the MPB-Hex were pooled and digested with factor Xa to separate the two proteins and then fractioned on SDS-PAGE (Figure 5). Sequence analysis shows that the MBP-Hex fusion protein contains a single Factor Xa target sequence, located at the fusion site between MBP and Hex. Thus we would have anticipated this treatment would have released a ~17.5 kDa protein-the size of full-length Hex. Instead, treatment of the MBP-Hex protein with Factor Xa produced two fragments, one the approximate size of MBP, and the other roughly 6 kDa (Figure 5). Repeated attempts to generate the full Hex (MW ~16 kDa) from the MBP-Hex fusion by cleaving the fused peptide with the Factor Xa under various conditions, or sources of Factor Xa failed. We are unsure as to why we are unable to obtain full length Hex by Factor Xa treatment. However we hypothesized that this 6 kDa protein fragment represented a stable fragment of Hex and proceeded to analyze this Hex fragment.

To determine whether the 6 kDa protein fragment that results from factor Xa cleavage of the MBP‑Hex fusion is a fragment of Hex, we cut this fragment out of a 15% SDS-polyacrylamide Tris‑Tricine gel, and determined its sequence by MALDI-TOF mass spectrometry. The resulting sequence confirmed this peptide derives from full length Hex. The shortened Hex polypeptide (hereafter referred to as sHex) sequence begins with glutamic acid 43 and ends with asparagine 103 (see Figure 1).

We determined whether sHex is capable of complementing the effects of Hex deletion. To accomplish this, we amplified DNA encoding the sHex sequence and placed expression of sHex gene under the control of the T7 RNA polymerase promoter in pET17b [16], creating the plasmid p-sHex. The sequence of this protein is as given in Figure 2, except it contains an initiator methonine precedingE43. MG1655(λ^imm434hex−) lysogens were transformed with p-sHex together with pGP1-2 which encodes a T7 RNA polymerase under the control of the temperature sensitive cI857 mutant λ repressor [16]. As a control, MG1655(λ^imm434hex−) cells were transformed with pGP1-2, and pET17b lacking the sHex insert. Cultures of these cells were grown to saturation overnight at 32 °C, washed, and resuspended in fresh medium and incubated at 37 °C for four hours. After 4 hours, the spontaneous induction frequencies of λ^imm434hex− prophages in MG1655 with or without the sHex encoding plasmid were determined as described (Experimental Section). Expression of sHex reduces the spontaneous induction frequency of Hex^- lysogens by ~7-fold compared to cells transformed with control plasmid (Figure 6). This finding indicates that sHex can act in trans to partially complement the hex- defect in λ^imm434hex−. This observation suggests that sHex constitutes the ‘active’ fragment of Hex.

The results in Table 1 suggest that Hex may alter the spontaneous induction frequency of λ^imm434 prophages by interfering with RecA mediated autocleavage of the 434 repressor, thereby reducing the amount bacteriophage 434 produced. To test this hypothesis we purified sHex as described in the Experimental Section and examined the effect of this protein on RecA-mediated autocleavage of 434 repressor. Mixing sHex (5 µM) with 300 nM 434 repressor does not result in the formation of any 434 repressor cleavage products (Figure 7A, lane 2), whereas mixing 434 repressor with RecA (see Experimental Section) causes the formation of two lower molecular weight antibody reactive species (Figure 7A, lane 3). The molecular weights of these products correspond to the 434 repressor N- and C-terminal domain fragments, consistent with the previous observation that RecA stimulates 434 repressor autocleavage [17]. When increasing concentrations of sHex are added into mixtures of 434 repressor and RecA, the amount of repressor cleavage products observed progressively decreases (Figure 7A, lanes 5–8). In an identical set of experiments in which increasing concentrations of BSA instead of sHex were added into the mixtures of 434 repressor and RecA, BSA did not interfere with the reaction (Figure 7B) Therefore the findings in Figure 7 indicate that sHex interferes with the ability of RecA to catalyze autoproteolysis of 434 repressor in vitro.

To determine whether or not the sHex inhibition of RecA stimulated autoproteolysis is specific to the 434 cI repressor, we examined the effect of sHex on RecA stimulated autocleavage of related cI repressors from lambdoid phages P22 and λ, as well as the SOS repressor LexA, which also undergoes RecA stimulated autocleavage. In an identical procedure as described above, we examined the effect of adding sHex on RecA stimulated autocleavage of P22 repressor (Figure 8A), λ repressor (Figure 8B) and LexA repressor (Figure 8C). Similar to the case with 434 repressor, added sHex interferes with the RecA stimulated autocleavage of P22 repressor (compared Figure 8A with Figure 7A). In contrast, added sHex does not inhibit RecA mediated autocleavage of the λ repressor (Figure 8B) under these conditions. Similar to the λ repressor case, sHex is also incapable of blocking RecA stimulated autocleavage of the SOS repressor LexA (Figure 8C) under these conditions.

Liquid cell cultures were grown in Luria broth or M9 minimal media [25], each of which were supplemented with 100 μg/mL ampicillin and 30 μg/mL kanamycin, where needed, to select for the presence of plasmids.

The host strain used for all spontaneous induction analysis was MG1655 [26,27]. The MG1655 recA mutants were created by P1 transduction using a lysate from E. coli GW4212, which bears the recA938::cat allele [28] (a gift from Mark Sutton, University at Buffalo, Buffalo, NY, USA). Both wild type and the recA mutant MG1655 were lysogenized with λ^imm434 or λ^{imm434: hex−} as previously described [8]. The hex mutant version of λ^imm434 was a gift from Lynn Thomason, Center for Cancer Research, National Cancer Institute at Frederick, Frederick, MD, USA. This phage was generated completely replacing the Hex coding sequence with that encoding the gene for chloramphenicol acyltransferase flanked by its promoter and transcription terminator. The replacement was done by recombineering.

The Hex DNA sequence ATGGCCTATGACTCCTATCAACGGGAACTGCAAGATTATCGGTGTTGTCGTGGAAGCGAGGGTAAAATTCGTATGATCAGGATTGCGGCGCTACTCTCAATACTCTTAACTACCAGCGCCAATTCTGAATGCTGGATTGTCACAAACCTGCACGGGTACGGGGCAATGAATGGCGATCGTTACGAGTTTACAAAAGACAGCACGGAAGATTCCGTTTTCAACGTAACAATAAATGGCGATAAATCATCAGTTTATGAATCAGTTTCTGGCGTCTATCCAGAGATGAAATACACTGCTTTGTCATCGAACACTATGGTAGGAGAATACCAGTCTGGAGGAGGCATAACCGTTGAAACTTGGTCAATCACTACAGACAAAAAAGCTCTTTACTCCAAAGTAATGAACATCCCAGGTATGCAACAACTTACATCAACCAAATCCTTTGTTGGTGATGTAGTCGGAACCTGCAATCAGTAAT was PCR amplified and cloned into XbaI and HindIII sites of pMAL-c2X (New England Biolabs), generating a MBP-Hex fusion. This construct encodes a Factor Xa cleavage site in the linker between Hex and MBP. Expression of this fusion protein is under control of the IPTG (isopropyl-β-_D-thiogalactopyranoside) inducible lac promoter. A truncated version of Hex (short hex—sHex) was created by PCR amplifying the following sequence from the central portion of the hex gene: GAATGCTGGATTGTCACAAACCTGCACGGGTACGGGGCAATGAATGGCGATCGTTACGAGTTTACAAAAGACAGCACGGAAGATTCCGTTTTCAACGTAACAATAAATGGCGATAAATCATCAGTTTATGAATCAGTTTCTGGCGTCTATCCAGAGATGAAATACACTGCTTTGTCATCGAAC using forward primer 5'-GGCCATCATATGGAATGCTGGATTGTC-3', and a reverse primer 5'-CCAGCGCTCGAGTTAGTTCGATGACAAAGC-3' (IDT Technologies). This DNA fragment was cleaved with NdeI and XhoI (New England Biolabs), purified and ligated into pET17b (Novagen) which was cleaved with the same enzymes.

RNA was isolated from MG1655^λimm434 as described in reference [29]. Briefly, cell cultures were grown to OD₆₀₀ = 0.6, collected by centrifugation at 12,000 × g at 4 °C, and resuspended in protoplasting buffer (15 mM Tris-HCl pH 8.0, 0.45 M Sucrose, 8 mM EDTA) containing 50 mg/mL lysozyme, and incubated 15 minutes on ice. Protoplasts were collected by centrifugation for 5min at 5,900 × g 4 °C, resuspended in 0.5 mL gram-negative lysing buffer containing DEPC, and incubated for 5 min at 37 °C. The RNA was precipitated from the preparation by adding saturated NaCl (34g/100 mL of water) and 100% ethanol, in an overnight incubation at −20 °C. The RNA was collected by centrifugation and washed with ice-cold 70% ethanol, dried, and dissolved in DEPC‑treated water. The RNA was digested for 10 minutes with RNAse-free DNase I (Promega Madison, WI, USA) which was subsequently deactivated at 65 °C for 10 minutes. The RNA was immediately used in RT-PCR reactions. Synthesis of first-strand cDNA was performed using AffinityScript^TM QPCR cDNA Synthesis Kit (Qiagen Valencia, CA, USA). The primer 5'‑CGAGATTGAGGTGGGGATTAC-3' was incubated with 3 μg total RNA, first strand master mix, AffinityScript RT/RNase block enzyme mixture, and incubated at 25 °C for 5 minutes, followed by 15 minutes in 42 °C. The reaction was terminated by placing the mixture at 95 °C for 5 minutes, chilled on ice, and immediately used in PCR with the following primer combinations: 5'-CGCGTCCAGTATCTACTAACA-3' with 5'-CAGCTTGGACTTAACCAGGCT-3', or 5'-CGAGATTGAGGTGGGGATTAC-3' with 5'-CAGCTTGGACTTAACCAGGCT-3'. The PCR products were fractionated by electrophoresis on agarose gels.

Measurements of spontaneous induction frequency were performed as described previously [30]. Briefly, cultures of MG1655 lysogenized with λ^imm434 or λ^{imm434 hex−} were grown to saturation overnight in LB or M9 minimal media at 37 °C. Phage that spontaneously produced overnight were removed from the stationary cells by washing three times with fresh medium. During the last wash the cells were resuspended in a volume of fresh medium that was equal to the starting culture volume. The cultures were incubated with shaking at 37 °C for 5 hours. Cell cultures were then centrifuged at 8,000 × g, and the phage-containing supernatant was sterilized by addition of chloroform. To determine the number of CFU (colony forming units), an aliquot of the remaining phage culture was evenly spread over Luria broth (LB) solidified with Luria agar (LA) in a Petri dish. The amount of phage released into the supernatant was determined by evenly distributing the released phage on nonlysogenic MG1655 as described previously [8]. The amount of phage released per cell in culture was calculated as the plaque forming units PFU/CFU ratio.

Standard methodologies were used for determining the mean number of phage particles per bacterium [31,32] Briefly, phage particles at a concentration of 1 × 10⁷ pfu mL⁻¹ were mixed with 1 × 10⁸ cfu mL⁻¹ MG1655 in LB supplemented with 10 mM MgSO₄ and 5 mM CaCl₂ for 5 minutes at 37 °C. The mixture was diluted 10,000-fold with pre-warmed LB to give a final culture volume of 10 mL. At intervals up to 75 minutes, two 0.2 mL samples were acquired to determine amount of unadsorbed (U) phage particles and total (T) phage particles. The U phage particles were additionally treated with 2% CHCl₃. The burst size is calculated as where F is the final phage count at time point 75 minutes and T and U are total and unadsorbed phage, respectively.

The MG1655 λ^{imm434 hex−} strain was transformed with pET17b bearing the short Hex gene under the T7 RNA polymerase promoter, together with plasmid pGP1-2 which contains temperature inducible T7 RNA polymerase [16]. Control MG1655 λ^{imm434 hex−} lysogens were transformed with plasmids pGP1-2 and pET17b that does not express any Hex derivatives. The cultures were grown overnight at 32 °C, and the cells collected by centrifugation as described above, washed three times and resuspended in a volume that was equal to the starting culture volume, and incubated at 37 °C for three hours. Cell cultures were then centrifuged at 8,000 × g and the phage containing supernatant was sterilized by addition of chloroform. To determine the number of CFU, an aliquot of the remaining phage culture was evenly spread on LB/LA Petri dish as described above. The amount of phage released into the supernatant was determined by infecting nonlysogenic MG1655 as described previously [8]. The amount of phage released per cell in culture was calculated as the PFU/CFU ratio.

The standard buffer used in all assays contained 50 mM KCl, 15 mM Tris (pH 7.5), 2 mM MgCl₂, 0.1 mM EDTA, 2 mM dithiothreitol. Concentrations of repressors from phage 434, λ, P22, and LexA in each reaction was 300 nm. λ repressor and anti-lambda repressor antibodies were a gift from Ann Hochschild (Harvard University Medical School, Cambridge MA, USA). LexA and anti-LexA antibodies were a gift from John Little, (University of Arizona, Tuscon, AZ, USA). Reaction mixtures were incubated 10 minutes at room temperature with different repressors, 0.5 mM γ-S-ATP, 2 mM DTT, and 3 μM oligo(dT₂₀). After incubation, RecA protein was added to a final concentration of 8 µM, and the mixture was then incubated for 2 hours at 37 °C. Following incubation, Tris/Tricine loading dye (0.1 M Tris, pH 6.8, 1% sodium dodecyl sulfate (SDS), 20 mM 2-mercaptoethanol, 20% glycerol, 0.01% bromophenol blue) were added, and the samples were boiled for 5 min. The products were fractionated by electrophoresis on 15% SDS-polyacrylamide Tris-Tricine gels [33]. The repressor and its cleaved products were visualized by chemiluminescent detection of Western blots by a Storm Imager using an ECL-Plus kit (both obtained from GE Life Sciences, Piscataway, NJ, USA) with horseradish peroxidase secondary antibody.

A saturated, overnight culture of BL21(DE3)::pLysS with pMAL-c2X (New England Biolabs, Beverly, MA, USA), bearing the full Hex sequence, was diluted 1:50 in three liters of LB broth supplemented with 100 µg of ampicillin/mL and 20 µg of chloramphenicol/ml. The culture was grown for 2 hours at 37 °C. Cultures were induced to produce Hex by the addition of 0.5 mM IPTG. After additional growth for 4 hours at 37 °C, the cells were harvested by centrifugation at 10,000 × g for 10 minutes, and the cell pellet was resuspended in 30 mL of lysis buffer (100 mM Tris [pH 7.5], 200 mM NaCl, and 10 mM EDTA). All subsequent procedures were performed at 4 °C. The cells were lysed by using a French press, and the cell lysate was diluted to 100 mL with lysis buffer. The lysate was centrifuged at 10,500 × g for 20 minutes to remove cellular debris. The resulting supernatant was passed through a 2 mL Amylose resin column, washed three times with 5 bed volumes of resin buffer (100 mM Tris [pH 7.5], 500 mM NaCl), and eluted with resin buffer plus 10mM maltose in 500 µL fractions. The purification progress was monitored by analyzing fractions collected at each step by SDS-PAGE. MBP-Hex fractions were pooled and digested with factor Xa (Qiagen, Valencia, CA, USA) as specified by this manufacturer. Expected size of Hex peptide is ~17.5 kDa. The products were analyzed on 15% SDS-polyacrylamide Tris-Tricine gels. Unexpectedly, no full length Hex protein was observed. Instead, a ~6 kDa product was observed to accumulate. This product was cut out from the gel and its amino acid sequence was determined using MALDI-TOF MS analysis. Subsequently, DNA encoding this sHex (short Hex) was PCR amplified, cloned and expressed as described above. Purification of sHex was performed as described for the MBP-Hex fusion protein, except after breaking the cells and centrifuging the lysate at 10,500 × g for 20 minutes to remove cellular debris, sHex was precipitated from solution with addition of ammonium sulfate to the final concentration of 10%, and harvested by centrifugation at 10,000 × g for 10 minutes. The insoluble pellet was dissolved in final concentration of 4 M Guanidine-HCl (GuHCl) in 100 mM Tris [pH 7.5], 100 mM NaCl, and passed through 20 cm Sephadex G50 column equilibrated with the same buffer. The sHex containing fractions were pooled, concentrated, and dialyzed in buffers of successively lower concentrations of GuHCl in order to remove GuHCl. Purity of sHex was monitored by SDS-PAGE.