To study the functions of IE0 independently of IE1, we constructed phspie0M, a plasmid that bore ie0 cDNA under the control of the Drosophila heat shock promoter hsp70, and introduced a mutation in the second ATG codon changing it to GCG, thus eliminating translation of IE1 (see Experimental Section).

To determine if IE0, expressed from the above obtained plasmid, phspie0M, was able to transactivate the baculovirus promoter 39K, we co-transfected variable amounts of phspie0M, namely 40, 80 and 160 ng with a fixed amount of the plasmid p39QlacZ (bearing the lacZ gene driven by the 39K promoter linked in cis to the hr5 enhancer). Expression of ie0 from the hsp70 promoter enhanced expression of lacZ, by 40, 85 and 140-fold respectively (Figure 1). Co-transfection of 160 ng of phsp70ie1, expressing ie1 with p39QlacZ resulted in 60 fold activation (not shown).

In vivo experimentation with mutants of IE0 indicated that it was able to replace to some extent the function of IE1 in AcMNPV replication. To test directly if IE0 was able to replace IE1 in supporting AcMNPV DNA replication, we examined the ability of IE0 to drive replication of the plasmid pQ35 bearing an AcMNPV origin of replication hr5 in a transient assay. To this end, we replaced phspie1 by phspie0M in Sf9 cells transfected with a library of plasmids bearing the AcMNPV genes required for efficient DNA replication: dnapol, helicase, ie-2, lef-1, lef-2, lef-3, lef-7, p35 (see Experimental section). In the absence of phspie0M the library lacking phspie1 did not replicate the plasmid pQ35 (Figure 2, lane 1). Addition of phspie0M promoted replication of pQ35, as achieved by adding phspie1 (Figure 2, lanes 2 and 3, respectively).

Previous reports based on indirect data indicated that IE0 may localize at the nucleus of the cell during infection but no formal demonstration of this ability of IE0 was provided. To answer this question we first produced an anti-IE0 antibody that exclusively recognizes IE0 by expressing its N‑terminal amino acids absent in IE1 (see Experimental Section). Infection of Sf9 cells with AcMNPV allowed us to confirm the specific recognition of IE0 by the anti-IE0 antiserum at various times of infection as compared to the simultaneous recognition of IE0 and IE1 with an anti-IE1/IE0 antiserum previously described, (Figure 3a,b, lanes 4, 8, 24, respectively). Neither of the antisera used reacted with any polypeptide in the mock-infected cells (Figure 3a,b, m.i.) Second, to localize IE0, Sf9 cells were infected with AcMNPV and fixed at 16 h post infection. The fixed cells were immunoreacted with anti-IE0 antiserum and decorated with anti-rabbit IgG fraction Alexa Fluor 488 (green). It can be seen that IE0 localized to the cell nucleus stained by DAPI (blue) in contrast to mock-infected Sf9 cells (Figure 3c,d, respectively). Moreover, Western blot analysis of biochemically fractionated cell nuclei and cytoplasm from a recombinant AcMNPV-infected Sf9 cells confirmed that IE0 localizes at the cell nucleus (Figure 3e, panel AcMNPV). Biochemical fractionation of Sf9 cells infected separately with a recombinant AcMNPV expressing a GST1-tagged IE1 that localizes to the cell nucleus and, with an AcMNPV recombinant expressing GFP that localizes exclusively to the cytoplasm, served as positive and negative controls (Figure 3e, panels labeled vAcGSTIE1 and vAcGFP, respectively).

Since IE0 bears a Basic domain (BDII) and a helix-loop-helix domain (HLH), C-terminal motifs present in IE1, we introduced selected mutations into these motifs and studied their effect on the functions of IE0. Thus, we constructed four different double mutants of IE0: two mutants in the BDII motif, R⁵⁷⁸A/K⁵⁸⁰A (p578/580) and R⁵⁹¹A/R⁵⁹²A (p591/592); and two mutants in the HLH motif, L⁵⁹⁷D/L⁶⁰¹E (p597/601) and L⁶⁰⁴D/I⁶⁰⁸E (p604/608). Expression of the mutant IE0 proteins was confirmed by immunoblot in Sf9 cells transiently transfected with the corresponding plasmids (Figure 4a). Then, we studied the ability of the mutants of IE0 to enter the cell nucleus following transfection of Sf9 cells with their corresponding plasmids. As can be seen, only mutant IE0 expressed from p578/580 was able to enter the cell nucleus in contrast to the mutants expressed from p591/592, p597/601 and p604/608 (Figure 4b).

To evaluate whether the mutant proteins were able to perform the functions of IE0, we examined their ability to transactivate the 39K promoter and to promote replication of the hr5-bearing plasmid in our transient-transfection assays described above. Only p578/580 was able to transactivate expression from the 39K promoter (Figure 5). Moreover, this mutant was the only one able to replicate the plasmid pQ35 in our transient replication assay (Figure 6). A summary of the properties of the IE0 mutants is shown in Table 1.

Finally, we studied the function of these mutants of IE0 when they were co-transfected with wild type IE0 in the p39QlacZ transactivation assay. Co-transfection of the plasmid mutant p578/580 with phspie0M (80 ng of each plasmid) activated p39QlacZ to the same extent of activation achieved by transfecting a total equal amount of phspie0M (160 ng). On the other hand, replacing the latter mutant with either p591/592; p597/601 or p604/608 resulted in 76 to 51% inhibition of the transactivation ability of IE0 (Figure 7).

S. frugiperda Sf9 cells were maintained and propagated in TNM-FH medium supplemented with 10% heat-inactivated fetal bovine serum and infected with wild-type AcMNPV E-2 strain as described previously [35,36].

vAcGSTIE1, is a recombinant virus bearing an extra copy of ie1 engineered in the polyhedrin locus of AcMNPV using pFastBac as a transfer vector. This extra copy of ie1 expresses the GST epitope fused in frame to the N-terminus of IE1. vAcGFP was described before [37].

Phspie1 and phspie0 bearing the ie1 and ie0 coding regions under the control of the D. melanogaster hsp70 promoter were described before [28,38]. phspie0M was obtained by replacing the second ATG of the ie0 open reading frame of phspie0 by GCG (Met to Ala) utilizing oligonucleotide-site directed mutagenesis with the primers IE1M3-CCAAGTGACTGCGACGCAAATTA and IE1M3R-TTGCGTCGCAGTCACTTGGTTG and the methodology described previously [28,39]. Changing the above Met to Ala in IE0 was shown to abolish synthesis of IE1 and we confirmed that result ([5] and not shown). Similarly, C-terminus mutants of IE0 were constructed utilizing the primers: 578/F580CCGATTACAAACATATGATGCGCAAATGCATTATATTTTTG and 578/580R CAAAAATATAATGCATTTGCGCATCATATGTTTGTAATCGG; 591/592F GCAATGTAGTGCTCTCTGCTGCGTTAACTTTACCGATTAC; and 591/592R GTAATCGGTAAAGTTAACGCAGCAGAGAGCACTACATTGC; 597/601F TAAAGCTAACAATTTGAGCTCATTATTGTGGTCTGTAGTGCTCTC; and 597/601R GAGAGCACTACAGACCACAATAATGAGCTCAAATTGTTAGCTTTA; 604/608F CGGAACCAGACCCTGGAGCTCTAAAGCTAAGTCTTTTAACAAATTATTG and 604/608R CAATAATTTGTTAAAAGACTTAGCTTTAGAGCTCCAGGGTCTGGTTCCG.

pET-IE0^1–44, an expression plasmid of exon0 (encoding IE0^1–44), was constructed using the T7 expression vector pET22b (−) (Novagen). Since the ie0 ORF contains 2 exons (exon 0 and exon1), a hybrid-PCR strategy was used for the fusion of exon0 and exon1 as described before [28]. The exon0‑exon1 fused fragment obtained was digested with EcoRI and HincII, ligated to the EcoRI, SmaI site of pBSK vector to obtain pBSKexon0. Then the EcoRI-NotI fragment from pBSKexon0 was cloned to the corresponding sites in pET 22b (−) vector to obtain pET-IE0^1–44. In pET-IE0^1–44, exon0 was in frame with the His₆-tag ORF at the C-terminus and the pe1B leader sequence at the N-terminus and expression was controlled by the T7 promoter, thus it expresses exclusively the IE0 N-terminal amino acids absent in IE1.

pQ35, that contains the complete p35 gene with its own promoter and a hr5 enhancer, was derived by inserting the corresponding XhoI-SacI fragment of about 3 kb from the AcMNPV genome to pBSK.

pQ39LacZ, in which the LacZ gene was under the control of viral 39K promoter linked with a hr5 enhancer: the LacZ gene was cut from pCMVβ (Clontech) with BamH I and inserted to the BamH I site of vector p39QCAT [1] replacing the cat ORF.

Expression in E. coli, transformed with pET-IE0^1–44, was induced by adding IPTG and incubating the culture overnight at 37 °C. A bacterial lysate was obtained and the His-tagged recombinant peptide purified by affinity chromatography on Ni²⁺ beads as described before [35]. Protein purity was more than 90% as judged by SDS-PAGE (not shown). New Zealand white rabbits were immunized and antiserum was prepared commercially using standard procedures (Hylabs, Il).

Transient β-galactosidase (LacZ) assay. 1–2 × 10⁵ Sf9 cells were transfected with the reporter plasmid pQ39LacZ and the tested plasmids (phspie1, phspie0 or phspie0M). LacZ reporter assays were described before [40]. The experiments were performed in duplicates, three biological repetitions.

Transient DNA replication assays were performed following the methodology previously published [10] and by utilizing pQ35, that served not only as a plasmid expressing p35 but also as a reporter plasmid in the replication assay since it contained the replication origin hr5 (see below). The replication library consisted of nine pBSK-based vectors bearing the AcMNPV genes dnapol, helicase, lef-1, lef-2, lef-3, p35, ie-2 and lef-7, ie1, and p35 required for efficient transient DNA replication [2,5,10,41,42]. p35 was expressed from pQ35. DpnI digestion was used to differentiate between input plasmid from bacterial containing methylated deoxyadenosine residues and plasmid DNA replicated in the insect cells [10]. Sf9 (2.6 × 10⁶) cells were co-transfected with the replication library containing 500 ng of each plasmid (with or without out phspie1), and various amounts of phspie0M. At 4 h post transfection, the cells were heat shocked at 42 °C for 30 minutes. Total intracellular DNA was isolated at 72 h post transfection, digested with DpnI, linearized with XhoI, electrophoresed on a 0.7% agarose gel, and transferred to a GeneScreen Hybridization Transfer Membrane (NEN^TM Life Science products, Inc., Boston, MA, USA)). Hybridization was performed with a Fluorescein dUTP‑labelled pQ35 probe. Probe-labeling, hybridization and signal detection were performed according to the protocol of the Renaissance random primer Fluorescein labeling kit (NEN^TM). The replicated complexes were detected by chemiluminescence.

Virus-infected (MOI of 5) or plasmid-transfected cells were harvested and subjected to SDS‑polyacrylamide gel electrophoresis (PAGE) with a pH 9 separating gel; this procedure allowed us to distinguish clearly the IE0 molecular species from the IE1 molecular species. Immunoblot analysis was performed with anti-IE0/IE1 [30], anti-IE0 (1:1000 dilution), anti-GFP and anti-GST, as previously described [30].

Sf9 cells (2 × 10⁵) were infected with AcMNPV, or transfected with plasmids encoding IE0 or IE0 mutants. The cells were collected at 16 h postinfection or at 48 h post-transfection, washed with PBS, and fixed with 2% formaldehyde, 0.2% glutaraldehyde for 5 min at 4 °C. Subsequently, the cells were washed with PBS and permeabilized with 0.15% Triton X-100 in PBS for 10 min, washed in PBS, blocked with 2% BSA in PBS for 1 h at RT and finally incubated with anti-IE0 or mouse anti-GST antisera in blocking solution. The fixed cells were subsequently incubated with anti rabbit IgG fraction Alexa Fluor488 (Invitrogen) for 30 min. Nuclear staining was performed with DAPI. The cells were subsequently washed in PBS and observed by confocal microscopy. Microscopy was performed with an Olympus IX 81 inverted laser scanning confocal microscope. Three dishes per transfection were used and the experiments were repeated twice.

Sf9 cells (4 × 10⁵) were infected with AcMNPV, vAcGSTIE1 or vAcGFP, or transfected with plasmids encoding IE0 or the above IE0 mutants or IE1. The cells were collected at 16 h postinfection or at 48 h post-transfection, washed with PBS, and lysed by suspension in in 170 µL of TBN buffer (10 mM Tris [pH 6.5], 140 mM NaCl, 0.5% NP-40, 3 mM MgCl₂, protease inhibitors) for 15 min on ice. After clarification by centrifugation at 5,220 g, 5 min, the supernatant was retained as the cytosolic fraction. The pellet was washed with TBN buffer (250 µL), lysed by suspension for 15 min on ice with 50 µL of lysis buffer (62.5 mM Tris [pH 6.8], 40% glycerol, 4% sodium dodecyl sulfate [SDS], 3% dithiothreitol), and forced 10 to 20 times through a 25-gauge needle. After clarification by centrifugation (16,000 g, 10 min), the supernatant was retained as the nuclear fraction. To analyze total cell proteins, a sample of the cell suspension was removed prior to cell lysis and mixed with an equal volume of 2% β-mercaptoethanol-2% SDS. All the fractions obtained were subjected to SDS‑PAGE and immunoblot analysis. The experiment was repeated three times (duplicate transfections per sample).