It has been found that IR can cause damage to multiple organs, leading to changes of organ indexes, including a decline in the spleen index and thymus index, but a rise in lung index [24,25]. To determine whether RE-CE treatment protected mice from IR-induced organ index changes, mice were exposed to 4 Gy TBI and treated with the vehicle or RE-CE as described in the Materials and Methods. As shown in Figure 1A,B,D,E, 50 mg/kg RE-CE treatment significantly attenuated the reduction in the spleen index and thymus index of irradiated mice, while the 25 mg/kg RE-CE treatment showed a slight effect. Interestingly, the lung index of irradiated mice was markedly decreased by consumption of 50 mg/kg CE as well as 25 mg/kg RE-CE (Figure 1C,F). The thymus and spleen of irradiated mice atrophied and exhibited decreased lymphocytes compared to the controls. Congestion and inflammatory cell infiltration could be observed in the lungs of irradiated mice. CE treatment alleviated these pathological changes (Figure A1). In addition, 50 mg/kg RE-CE treatment attenuated the declines in total splenocyte and thymocyte counts in 4 Gy irradiated mice (Figure A1C,D). These findings suggest that RE-CE plays a protective role in IR-induced organ injury in mice, and the 50 mg/kg RE-CE treatment exhibits higher efficiency than the 25 mg/kg RE-CE treatment.

It has been well established that IR can induce myelosupression which is characterized by cytopenia accompanied with myeloid skewing in peripheral blood [26,27]. To determine whether RE-CE treatment promoted hematopoietic recovery in irradiated mice, we analyzed the number of different types of peripheral blood cells using a hematology analyzer, and the percentage of B cells, T cells, and myeloid cells using flow cytometry. As illustrated in Figure 2 and Figure A1, irradiated mice exhibited a significant decline in white blood cells (WBCs), lymphocyte percentage (LY%), and percentage of B cells and T cells, but an increase in neutrophil percentage (NE%) and percentage of myeloid cells in peripheral blood at day 14 after 4 Gy TBI, when compared to unirradiated controls. Treatment of 50 mg/kg RE-CE and 25 mg/kg RE-CE elevated WBC counts, LY%, B cell percentage and T cell percentage (Figure 2A,B,D,E and Figure A1), but reduced NE% and myeloid cell percentage (Figure 2C,F and Figure A1) in the peripheral blood of irradiated mice. The decline in WBC count was still found 2 months after 6 Gy TBI, and the 50 mg/kg RE-CE treatment attenuated such a decline (Figure A1B). These results suggest that RE-CE treatment promotes recovery from IR-induced myelosuppression and myeloid skewing to maintain hematopoietic homeostasis.

There was a notable decline in B cell percentage in BM after 4 Gy TBI, but RE-CE treatment increased the B cell percentage (Figure 3A). Additionally, the percentage of CD71⁺Ter119⁺ immature erythrocytes was elevated after 4 Gy TBI, but RE-CE treatment alleviated this effect of IR on immature erythrocytes (Figure 3B).

Since the exhaustion of HSPCs is a critical cause of myelosuppression, we examined whether RE-CE treatment attenuated the IR-induced decline in BM cells (BMCs) and HSPCs frequency. The 4 Gy and 6 Gy TBI irradiated mice both exhibited decreased BMCs, but RE-CE treatment attenuated these declines in the 4 Gy as well as 6 Gy irradiated mice (Figure 4A). As shown in Figure 4B–F, 4 Gy and 6 Gy TBI both caused a decrease in HPC (hematopoietic progenitor cells, Lineage⁻Scal⁻c-kit⁺), LSK (Lineage⁻Scal⁺c-kit⁺), and CD34⁺LSK (CD34⁺Lineage⁻Scal⁺c-kit⁺) frequency, and an increase in CD34⁻LSK (CD34⁻Lineage⁻Scal⁺c-kit⁺) frequency at day 14 after TBI. Furthermore, HSPCs exhibited a similar trend 2 months after 6 Gy TBI (Figure 4G–J). RE-CE treatment attenuated these effects in HPC (Figure 4B,G), LSK (Figure 4C,H), CD34⁺LSK (Figure 4E,J), and CD34⁻LSK frequency (Figure 4D,I). These results suggest that RE-CE treatment promotes recovery from IR-induced alternations in HSPCs frequency. The complete gating strategy for HSPCs is presented in Figure A2.

We conducted colony of granulocyte macrophage cells (CFU-GM) assays, spleen colony-forming units (CFU-S) assays, and competitive bone marrow transplantation to evaluate whether RE-CE treatment improved the colony forming and engraftment abilities of HSPCs in irradiated mice. The results revealed that the CFU-GM number remarkably decreased in irradiated mice compared to control mice, but RE-CE treatment attenuated this decline (Figure 5A). In addition, 6 Gy TBI stimulated the formation of spleen colonies and RE-CE treatment increased the number of CFU-S in irradiated mice (Figure 5B). At day 14 after 4 Gy TBI, hypoplastic bone marrow was observed in irradiated mice, but RE-CE-treated mice exhibited increased cellularity in bone marrow (Figure 5C). More importantly, 4 Gy and 6 Gy TBI both induced a reduction in engraftment after competitive bone marrow transplantation, but RE-CE treatment promoted donor cell engraftment in 4 Gy and 6 Gy irradiated mice 4 months after competitive bone marrow transplantation (Figure 5D and Figure A3). These data demonstrate that RE-CE treatment improves the colony forming and engraftment abilities of irradiated HSPCs.

IR may induce DNA damage in HSPCs, namely double strand breaks (DSBs), leading to cell apoptosis, dysfunctional cell growth, and ultimately hematopoietic disorders [4]. As shown in Figure 6, there is a noticeable increase in both apoptosis (Annexin V+) and the mean flourescence intensity (MFI) of phospho-histone H2AX (γH2AX) in irradiated LSKs, but RE-CE treatment markedly attenuated these trends (Figure 6). Similar results were obtained in c-kit positive cells (Figure A4). These results suggest that RE-CE promotes hematopoietic recovery probably by inhibiting IR-induced apoptosis and DNA damage in HSPCs.

The indirect effect of IR is mainly caused by ROS, which contribute to IR-induced hematopoietic injury. To determine whether RE-CE treatment reduced IR-induced ROS, we measured the MFI of 2,7-dichlorofluorescein (DCF), MitoSox, and dihydroethidium (DHE) in LSKs and c-kit positive cells 14 days after 4 Gy TBI to evaluate the total cellular ROS, mitochondria-derived ROS (superoxide), and superoxide free radicals levels, respectively. The MFI of 2,7-dichlorodihydrofluorescein diacetate (DCFDA) (Figure A5), MitoSox (Figure 7B), and DHE (Figure 7C) in c-kit positive cells was significantly elevated after radiation, but RE-CE treatment attenuated the IR-induced elevation in ROS levels. Similar results of total cellular ROS were observed in LSKs (Figure 7A). These results suggest that RE-CE serves as a free radical scavenger in irradiated mice.

Antioxidant enzymes minimize the perturbations caused by ROS under normal conditions. However, the significantly elevated production of ROS under pathological conditions overcomes cellular levels of antioxidants, inducing oxidative stress. To assess the effects of RE-CE on antioxidant enzymes, we measured the enzymatic activity of SOD, GSH-PX, and CAT in c-kit positive cells. Moreover, we also measured the glutathione (GSH) level which is a global cellular antioxidant. The results showed that 4 Gy TBI down-regulated the enzymatic activities of SOD, GSH-PX, and CAT, and decreased the GSH level in c-kit positive cells, but RE-CE treatment dramatically ameliorated the repression of these enzymatic activities and increased the GSH level. (Figure 8). We also confirmed the increase in transcripts of SOD1, SOD2, CAT, and GSH-PX in irradiated c-kit positive cells after RE-CE treatment (Figure A6). These findings indicate that the effects of RE-CE treatment on IR-induced hematopoietic injury may be, at least in part, attributed to ROS scavenging and enhancing antioxidant enzymatic activities in irradiated c-kit positive cells.

To test whether RE-CE affected the survival of irradiated mice, we fed mice with 50 mg/kg RE-CE or vehicle 30 min before radiation and up to 7 days after radiation. As shown in Figure 9, all vehicle-treated mice died within 24 days following 7 Gy TBI. However, 25% of RE-CE-treated mice were alive 30 days after TBI. These findings suggest that RE-CE treatment significantly increases the survival rate of irradiated mice.

To identify the major component that functioned as a radioprotector for the hematopoietic system in coriander extract, we performed liquid chromatography-mass spectrometry (LC/MS) analyses using liquid chromatography. As shown in Figure 10 and Table 1, flavonoids, phenolic acids, and coumarins were the main components in coriander extract, with rutin, quercetin 3-glucuronide, and nicotiflorin as the major compounds in the flavonoids.

Anti-mouse CD34 FITC (clone RAM34), anti-mouse CD3 APC (clone145-2C11), anti-mouse CD117 (c-kit) APC (clone 2B8), and anti-mouse Ly-6 A/E (Sca1) CE/Cy7 (clone D7) were purchased from eBioscience (San Diego, CA, USA). Biotin anti-mouse CD4 (clone GK1.5), CE anti-mouse CD4 (clone GK1.5), CE anti-mouse/human CD45R/B220 (clone RA3-6B2), biotin anti-mouse/human CD45R/B220 (clone RA3-6B2), PerCP anti-mouse/human CD45R/B220 (clone RA3-6B2), PerCP anti-mouse/human CD11b (clone M1/70), FITC anti-mouse/human CD11b (clone M1/70), biotin anti-mouse/human CD11b (clone M1/70), PerCP anti-mouse Ly-6G/ Ly-6C(Gr1) (clone RB6-8C5), biotin anti-mouse Ly-6G/ Ly-6C(Gr1) (clone RB6-8C5), CE/Cy7 anti-mouse Ly-6G/Ly-6C(Gr1) (clone RB6-8C5), biotin anti-mouse Ter119 (clone TER119), FITC anti-mouse Ter119 (clone TER119), FITC anti-mouse CD8 (clone 53-6.7), biotin anti-mouse CD8 (clone 53-6.7), CE anti-mouse CD71 (clone RI7217), and PerCP streptavidin were obtained from Biolegend (San Diego, CA, USA). Anti-γH2AX rabbit monoclonal antibody was purchased from Cell Signaling Technology (Danvers, MA, USA). FITC goat anti-rabbit IgG was obtained from ZSGB-BIO Origene (Beijing, China).

Male C57BL/6 (CD45.2) mice were purchased from the Institute of Laboratory Animal Sciences, Chinese Academy of Medical Sciences and Peking Union Medical College (Beijing, China). Male C57BL/6 (CD45.1) mice were purchased from the Institute of Hematology and Blood Disease, Chinese Academy of Medical Sciences and Peking Union Medical College (Tianjin, China). Male C57BL/6 (CD45.1/45.2) mice were bred in the experimental animal center of the Institute of Radiation Medicine. Mice were used at approximately 6 to 8 weeks of age. Animal experiments in our study were approved by the Animal Care and Ethics Committee of the Institute of Radiation Medicine (Permit number 1505, 1 Jan 2015). The study was performed in accordance with the principles of the Institutional Animal Care and Ethics Committee guidelines.

For evaluations of the organ index, histomorphology, peripheral blood cell counts, and HSPCs differentiation, mice were randomly divided into 4 groups, namely control, TBI, TBI + 25 mg/kg RE-CE, and TBI + 50 mg/kg RE-CE. For the other experiments, mice were also divided into 4 groups consisting of control, 50 mg/kg RE-CE, TBI, and TBI + 50 mg/kg RE-CE. Mice received 7 Gy TBI for the survival experiment, and 6 Gy or 4 Gy TBI in other experiments at a dosage rate of 0.99 Gy/min. Mice in control and RE-CE groups were sham-irradiated. CE was dissolved in distilled water (vehicle), and then administrated once a day by gavage 30 min before radiation and up to 7 days after radiation in RE-CE and TBI + RE-CE groups. Mice in the control and TBI groups received the same volume of vehicle for the same frequency and duration as those in CE or TBI + RE-CE groups. Mice were finally euthanized on the 14th or 60th day after TBI.

The body weight of individual mice was measured at the 14th day after exposure to 4 Gy TBI. The spleen, thymus, and lung were removed and weighed. The organ index was calculated according to the following formula: Organ index = [organ weight (g)/body weight (g)] × 10. Single cell suspensions of the spleen and thymus obtained by mechanical trituration were filtered and cells were counted. Specimens from spleen, thymus, and lung tissue were fixed with 4% formalin, embedded with paraffin, serially sectioned, and stained with hematoxylin and eosin. Specimens from the femur were decalcified with microwave and 10% ethylenediaminetertraacetic acid (EDTA) before being embedded.

Blood was obtained via the orbital sinus and was collected in EDTA tubes. The cell counts of peripheral blood including WBC counts, and LY% and NE% were analyzed with a hematology analyzer (Nihon Kohden, Japan). A Wright-Giemsa staining kit (Solarbio life sciences, Beijing, China) was used according to the manufacturer’s instructions.

BM cells (BMCs) were isolated from tibias and femurs, suspended in phosphate-buffered saline (PBS), filtered, and counted prior to antibody staining. For B cell, T cell, and myeloid cell analysis in peripheral blood, 50 µL peripheral blood was harvested and incubated with premixed antibodies of B220, CD3, Gr1, and CD11b at room temperature for 30 min, and subsequently red blood cells were removed with BD FACSTM Lysing Solution. For B cell analysis in BM, a 1 × 10⁶ BMC suspension was incubated with CD3 and B220 antibodies at 4 °C for 30 min. For immature erythrocytes analysis in BM, a 1 × 10⁶ BMC suspension was incubated with CD71 and Ter119 antibodies at 4 °C for 30 min. For the analysis of HPSC frequency, 5 × 10⁶ BMCs were incubated with biotin-conjugated antibodies specific for Gr1, Ter119, CD11b, B220, CD8, and CD4 and then stained with streptavidin, sca1, c-kit, and CD34 antibodies. Data acquisition was performed on a BD Accuri C6 and analyzed by BD Accuri C6 software (BD Bioscience, San Jose, CA, USA).

For CFU-GM assay, 1 × 10⁴ BMCs from unirradiated mice and 1 × 10⁵ BMCs from irradiated mice were cultured in M3534 methylcellulose medium (Stem Cell Technologies, Vancouver, BC, Canada) for 5 days. The number of CFU-GM containing more than 30 cells was counted according to the manufacturer’s instructions, and the results are expressed as the number of CFU-GM per 10⁵ BMCs. For the CFU-S assay, the spleen was soaked in trinitrophenol for 6 h and then the number of CFU-S was counted.

1 × 10⁶ BMCs from C57BL/6 (CD45.2) treated mice and 1 × 10⁶ BMCs from C57BL/6 (CD45.1/45.2) mice were mixed and transplanted into lethally irradiated C57BL/6 mice (CD45.1). The percentage of donor-derived (CD45.2) cells in the peripheral blood of recipients was examined 4 months after transplantation.

BMCs were stained with c-kit APC antibody for 30 min on ice. Then the cells were washed with PBS, and incubated with anti-APC microbeads (Miltenyi Biotec, Teterow, Germany) for 15 min at room temperature. C-kit positive cells were sorted by MACS using a LS column in the QuadroMACS™ Separator (Miltenyi Biotec, Teterow, Germany).

1 × 10⁶ c-kit positive cells or 5 × 10⁶ BMCs stained with LSK (Gr1, Ter119, CD11b, B220, CD8, CD4, sca1 and c-kit) antibodies were prepared to perform the apoptosis assay with an Annexin V-FITC Apoptosis Detection Kit (BD Biosciences, San Jose, CA, USA) according to the manufacturer’s protocol. Samples were collected by a BD Accuri C6 and analyzed using the BD Accuri C6 software (BD Bioscience, San Jose, CA, USA).

1 × 10⁶ c-kit positive cells or 5 × 10⁶ BMCs stained with LSK antibodies were fixed and permeabilized with BD Cytofix/Cytoperm buffer for 30 min at room temperature. After washed with BD perm/Wash buffer twice, cells were incubated with anti-γH2AX (1:100) for 1 h and then stained with FITC goat anti-rabbit IgG for 30 min at room temperature. The MFI of γH2AX in c-kit positive cells was detected by flow cytometry.

1 × 10⁶ c-kit positive cells or 5 × 10⁶ BMCs stained with LSK antibodies were stained with 2,7-dichlorodihydrofluorescein diacetate (DCFDA, Beyotime Biotechnology, Nanjing, China; 10 μΜ), MitoSox (Life Technologies, Grand Island, NY, USA; 10 μM), and dihydroethidium (DHE, Beyotime Biotechnology, Nanjing, China; 5 μM) for 20 min, 30 min, and 10 min, respectively, in a 37 °C water bath. The intracellular ROS levels of c-kit positive cells were analyzed by measuring the MFI of DCF, Mitosox, and DHE using a flow cytometer.

SOD, GSH-PX, GSH, and CAT enzymatic activities of c-kit positive cells were determined using the total superoxide dismutase assay kit with WST-8, total glutathione peroxidase assay kit, total glutathione assay kit, and catalase assay kit (Beyotime Institute of Biotechnology, Nanjing, China), respectively, according to the manufacturer’s instructions. Briefly, 1 × 10⁶ c-kit positive cell lysate or homogenate was added into the detection buffer, and the maximum absorption wavelength was examined at 450, 340, 412, and 520 nm by the colorimetric method for the detection of enzymatic activities of SOD, GSH-PX, GSH, and CAT, respectively.

The total RNA of c-kit positive cells was extracted with TRIzol reagent (Life Technologies, Grand Island, NY, USA). Reverse transcription was performed with a Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, Waltham, MA, USA), according to the manufacturer’s instructions. All PCRs were conducted under an ABI 7500 Sequence Detection System and GAPDH (Thermo, Waltham, MA, USA) was used as control. Three pairs of primers were designed for SOD2, CAT, and GSH, according to the sequences shown in a previous study [39]. The forward primer sequence of SOD1 was AACCAGTTGTGTTGTCAGGAC, and its reverse primer sequence was CCACCATGTTTCTTAGAGTGAGG.

RE-CE was purchased from ICTORY Biological Technology Co., Ltd. (Xi’an, China). The raw materials of coriander herbs were dried without access to direct sunlight after copious washing in running water. The dried materials were ground into a fine power and passed through a 40-mesh sieve. This powered product (500 g) was submitted to extraction with aquaous ethanol (30%, 5 L) in a shaker at 60 °C for 2 h. The extract waste was filtered out and the solution was concentrated by a rotary evaporator and dried under vacuum. The extract was stored at 4 °C for further use. LC/MS analyses were performed on a Shimadzu LC-30AD liquid chromatography interfaced with an IT-TOF mass spectrometer (Shimadzu Corp., Kyoto, Japan) with electrospray ionization. An ACOUITY UPLC BEH-C18 Column (1.7 μm) was used. The column temperature was 40 °C and the elution velocity was 0.3 mL/min. The sample extracts were analyzed using a gradient program, and the mobile phase consisted of 0.1% formic acid in water (solvent A) and HPLC grade methanol (solvent B). The gradient program consisted of: 5% B for 0 min, 95% B for 50 min, and 95% B for 60 min. The nebulizer gas flow rate was 1.5 L/min. CDL and block heater temperatures were both 200 °C. The spray and detector voltages were 4.5 and 1.58 kV, respectively. The scan time and mass range were 1.5 s and 50–1000 m/z, respectively. The injected volume was 2 μL.

Statistical analysis was performed using GraphPad Prism 5 software (GraphPad Prism Software Inc., La Zolla, CA, USA) with an unpaired t test (two-tails) and Welch’s correction t-test for mean comparisons. Survival rates were analyzed with the Kaplan Meier method and Log rank test. Data are presented as means ± SEM, and differences were considered statistically significant at p < 0.05.