Next Article in Journal
Affinity Purification of Binding miRNAs for Messenger RNA Fused with a Common Tag
Next Article in Special Issue
Resveratrol Induces the Expression of Interleukin-10 and Brain-Derived Neurotrophic Factor in BV2 Microglia under Hypoxia
Previous Article in Journal
The Effect of Fiber Bleaching Treatment on the Properties of Poly(lactic acid)/Oil Palm Empty Fruit Bunch Fiber Composites
Previous Article in Special Issue
Effects of (−)-Gallocatechin-3-Gallate on Tetrodotoxin-Resistant Voltage-Gated Sodium Channels in Rat Dorsal Root Ganglion Neurons
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Enhancement of Chlorogenic Acid Production in Hairy Roots of Platycodon grandiflorum by Over-Expression of An Arabidopsis thaliana Transcription Factor AtPAP1

1
Department of Crop Science, Chungnam National University, 99 Daehak-ro, Yuseong-Gu, Daejeon 305-764, Korea
2
Department of Integrative Plant Science, Chung-Ang University, Anseong 456-756, Korea
3
Department of Botany and Microbiology, Addiriyah Chair for Environmental Studies, College of Science, King Saud University, PO Box 2455, Riyadh 11451, Saudi Arabia
4
Department of Plant Science, Gangneung-Wonju National University, 7 Jukheon-gil, Gangneung-si, Gangwon-do 210-702, Korea
5
Visiting Professor Program (VPP), King Saud University, PO Box 2455, Riyadh 11451, Saudi Arabia
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2014, 15(8), 14743-14752; https://doi.org/10.3390/ijms150814743
Submission received: 30 May 2014 / Revised: 17 July 2014 / Accepted: 22 July 2014 / Published: 22 August 2014
(This article belongs to the Special Issue Pharmaceuticals and Nutraceuticals by Molecular Farming)

Abstract

:
To improve the production of chlorogenic acid (CGA) in hairy roots of Platycodon grandiflorum, we induced over-expression of Arabidopsis thaliana transcription factor production of anthocyanin pigment (AtPAP1) using an Agrobacterium rhizogenes-mediated transformation system. Twelve hairy root lines showing over-expression of AtPAP1 were generated. In order to investigate the regulation of AtPAP1 on the activities of CGA biosynthetic genes, the expression levels of seven P. grandiflorum CGA biosynthetic genes were analyzed in the hairy root line that had the greatest accumulation of AtPAP1 transcript, OxPAP1-1. The introduction of AtPAP1 increased the mRNA levels of all examined CGA biosynthetic genes and resulted in a 900% up-regulation of CGA accumulation in OxPAP1-1 hairy roots relative to controls. This suggests that P. grandiflorum hairy roots that over-express the AtPAP1 gene are a potential alternative source of roots for the production of CGA.

1. Introduction

Chlorogenic acid (CGA), which is composed of a family of esters between certain trans-cinnamic acids and quinic acid, is the major soluble phenolic compound found in tomatoes, potatoes, and tobacco. CGA is an important for plant metabolism. For example, it is a precursor of G- and S-type lignin biosynthesis and plays a prominent role in tissue senescence [1]. CGA possesses diverse health effects; it performs well as an antioxidant, particularly in protecting lipids from peroxidation, the initial event in atherosclerosis [2]. Although CGA was identified decades ago, the complete pathway for the synthesis of CGA is still debated [3]. Three distinct pathways have been considered (Figure 1): (1) caffeoyl-glycoside is used as the activated intermediate, (2) synthesis of CGA from caffeoyl-CoA and quinic acid by hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase (HQT), and (3) hydroxylation of p-coumaroyl-quiric acid by p-coumarate 3'-hydroxylase (C3H) to form CGA [4,5,6]. Due to the importance of CGA for plant and human health, the metabolic engineering of CGA biosynthesis in plants has attracted the interest of researchers for long time. Over-expression of transcription factors that regulate the transcription of genes involved in the phenylpropanoid pathway is an effective tool for engineering high levels of CGA. Arabidopsis thaliana production of anthocyanin pigment (AtPAP1) significantly increases accumulation of CGA [7] and activates most of the phenylpropanoid pathway genes in plants [8,9].
The root of Platycodon grandiflorum have been reported to have a wide range of health benefits, including anti-inflammatory, anti-lipidemic, anti-hypercholesteroleamic, and anti-obesity effects [10,11]. Many beneficial compounds have been isolated from the roots of P. grandiflorum, such as saponins, platycodon, phytosterols, polyacetylenes, and phenylpropanoids [12,13]. On the other hand, hairy roots, which are induced at or near the site of infection of a plant with Agrobacterium rhizogenes, have recently been considered as a promising alternative material for large-scale production of secondary metabolites because of their fast growth rate and biochemical and phenotypic stability [14]. Given the good characteristics of hairy roots and the richness of beneficial compounds in P. grandiflorum, the hairy roots of P. grandiflorum are probably a good model for assessing improvements in the production of a natural product through biotechnology.
The aim of this study was to establish an efficient approach for improvement of CGA production in hairy roots of P. grandiflorum by A. rhizogenes-mediated co-transformation. Here, the effect of exogenous AtPAP1 over-expression on the expression levels of CGA biosynthetic genes and CGA accumulation was investigated in P. grandiflorum hairy roots.
Figure 1. Three proposed pathways for chlorogenic acid synthesis in plants (labeled 1, 2 and 3). PAL, phenylalanine ammonia lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumarate CoA ligase; HCT, hydroxycinnamoyl CoA shikimate/quinate hydroxycinnamoyl transferase; C3H, p-coumarate 3'-hydroxylase; HQT, hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase; UGCT, UDP glucose: cinnamate glucosyl transferase; HCGQT, hydroxycinnamoyl d-glucose: quinate hydroxycinnamoyl transferase.
Figure 1. Three proposed pathways for chlorogenic acid synthesis in plants (labeled 1, 2 and 3). PAL, phenylalanine ammonia lyase; C4H, cinnamate 4-hydroxylase; 4CL, 4-coumarate CoA ligase; HCT, hydroxycinnamoyl CoA shikimate/quinate hydroxycinnamoyl transferase; C3H, p-coumarate 3'-hydroxylase; HQT, hydroxycinnamoyl CoA quinate hydroxycinnamoyl transferase; UGCT, UDP glucose: cinnamate glucosyl transferase; HCGQT, hydroxycinnamoyl d-glucose: quinate hydroxycinnamoyl transferase.
Ijms 15 14743 g001

2. Results and Discussion

2.1. Establishment of Transgenic Hairy Root Lines

The over-expression of AtPAP1 driven by the CaMV 35S promoter was induced in hairy roots of P. grandiflorum using A. rhizogenes strain R1000. The transgenic hairy roots over-expressing AtPAP1 were not morphologically different and did not differ in growth rate from control hairy roots that had CaMV 35S promoter-GUS fusion. Twelve hairy root lines showing over-expression of AtPAP1 were generated, and no AtPAP1 expression was detected in the control P. grandiflorum hairy root line (Figure 2). Of the transgenic hairy root lines, the OxPAP1-1 line had the greatest accumulation of AtPAP1transcripts and was selected for further analysis. In order to investigate the regulation of CGA biosynthetic genes by AtPAP1, the expression levels of PgPAL1, PgPAL2, PgC4H, Pg4CL, PgC3H, PgHCT, and PgHQT were analyzed in the OxPAP1-1 line. As seen in Figure 3, the introduction of the AtPAP1 gene dramatically increased the expression levels of all examined CGA biosynthetic genes in P. grandiflorum hairy roots. Control hairy roots were assigned a value of 1, and the expression levels of seven P. grandiflorum genes involved in CGA biosynthesis were several-fold higher in the OxPAP1-1 line than in control hairy roots. Relative to controls, the greatest increase in mRNA levels were observed for PgPAL2, PgHCT, and PgPAL1, with fold changes of 4.95, 3.99, and 3.29, respectively.
Figure 2. Expression levels of the Arabidopsis thaliana transcription factor production of anthocyanin pigment (AtPAP1) gene in P. grandiflorum transgenic hairy root lines. The height of each bar and the error bars show the mean and standard error, respectively, of three independent measurements. Control and OxPAP1-n, P. grandiflorum transgenic hairy roots by A. rhizogenes strain R1000 with pK7FWG2 plant binary expression vector carrying GUS and AtPAP1, respectively (n indicates the line number).
Figure 2. Expression levels of the Arabidopsis thaliana transcription factor production of anthocyanin pigment (AtPAP1) gene in P. grandiflorum transgenic hairy root lines. The height of each bar and the error bars show the mean and standard error, respectively, of three independent measurements. Control and OxPAP1-n, P. grandiflorum transgenic hairy roots by A. rhizogenes strain R1000 with pK7FWG2 plant binary expression vector carrying GUS and AtPAP1, respectively (n indicates the line number).
Ijms 15 14743 g002
Figure 3. Expression levels of PgPAL1, PgPAL2, PgC4H, Pg4CL, PgC3H, PgHCT, and PgHQT in the P. grandiflorum OxPAP1-1 hairy root line. Control hairy roots were assigned a value of 1 and results are expressed as means and standard deviation relative to the controls.
Figure 3. Expression levels of PgPAL1, PgPAL2, PgC4H, Pg4CL, PgC3H, PgHCT, and PgHQT in the P. grandiflorum OxPAP1-1 hairy root line. Control hairy roots were assigned a value of 1 and results are expressed as means and standard deviation relative to the controls.
Ijms 15 14743 g003

2.2. Chlorogenic Acid Production in Hairy Roots Over-Expressing AtPAP1

HPLC analysis showed that, relative to control hairy roots, CGA accumulation significantly increased in transgenic hairy roots transformed with A. thaliana transcription factor PAP1 (Figure 4 and Figure 5). The CGA content in the OxPAP1-1 hairy root line was 421.31 μg/100 mg of dry weight, i.e., 9.89-time higher than that the control hairy root line (42.60 μg/100 mg).
Figure 4. High-Performance Liquid Chromatography (HPLC) chromatograms of chlorogenic acid (CGA) analysis from control hairy roots (A) and OxPAP1-1 hairy roots (B) of P. grandiflorum.
Figure 4. High-Performance Liquid Chromatography (HPLC) chromatograms of chlorogenic acid (CGA) analysis from control hairy roots (A) and OxPAP1-1 hairy roots (B) of P. grandiflorum.
Ijms 15 14743 g004
Introduction of individual biosynthetic genes to transgenic plants increases the accumulation of CGA up to several times that of wild-type plants. CGA levels are increased approximately 3-fold by overexpression of PAL in transgenic tobacco [15]. Gene-silencing of HQT reduces 98% of CGA, while over-expression increases CGA content up to 85% in transformed tomato leaves [4]. The over-expression of transcription factors, which stimulate the expression levels of almost all of the biosynthetic genes, can further increase the CGA content in tomato (22 times) [16] and Saussurea involucrate (15 times) [7]. In this study, we found that the introduction of AtPAP1 led to increased mRNA levels for all examined CGA biosynthetic genes and a 9.89-time increase of CGA accumulation in P. grandiflorum hairy roots. Over-expression of AtPAP1 not only stimulated the expression levels of down-stream genes in the CGA biosynthetic pathway, causing the induction of CGA accumulation, but also increased the activities of four genes involved in the general phenylpropanoid pathway. The general phenylpropanoid pathway generates an enormous array of secondary metabolites, such as flavonoids, stilbenes, lignins, and rutin [17]. This suggests that the induction of PgPAP1, PgPAL2, PgC4H, and Pg4CL in the OxPAP1-1 line also up-regulated the biosynthesis of other phenylpropanoid compounds. Further studies of other compounds in P. grandiflorum hairy roots are needed to clarify this suggestion. In addition, the expression profiles of PgPAL1, PgPAL2, PgC4H, and Pg4CL in OxPAP1-1 hairy roots will enhance our understanding of the transcriptional regulation of phenylpropanoid biosynthesis in P. grandiflorum.
Figure 5. Chlorogenic acid content in P. grandiflorum hairy roots transformed with AtPAP1 over-expression constructs. The height of each bar and the error bars show the mean and standard error, respectively, of three independent measurements. P35S, CaMV 35S promoter; T35S, 3' termination signal of CaMV 35S gene.
Figure 5. Chlorogenic acid content in P. grandiflorum hairy roots transformed with AtPAP1 over-expression constructs. The height of each bar and the error bars show the mean and standard error, respectively, of three independent measurements. P35S, CaMV 35S promoter; T35S, 3' termination signal of CaMV 35S gene.
Ijms 15 14743 g005

3. Experimental Section

3.1. Plasmid Construction

Polymerase chain reaction (PCR) was used to generate AtPAP1 coding regions (GenBank accession number: NM_104541.3). Purified DNA fragments of eight genes were recombined into a pDONR 221 vector using BP clonase II (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Recombinant plasmids were transformed into TOP10 Escherichia coli cells (Invitrogen, Carlsbad, CA, USA) using kanamycin selection at a final concentration of 50 g/mL. After confirming the plasmid inserts by sequencing, the pDONR221 gene construct was excised and recombined into pK7FWG2 (http://www.psb.ugent.be/gateway/) [18] using LR clonase (Invitrogen, Carlsbad, CA, USA). The over-expression construct consisted of a cauliflower mosaic virus (CaMV) 35S promoter, AtPAP1 sequences, and the neomycin phosphotransferase (NPTII) gene as a selectable marker (Figure 5). The pK7FWG2 plasmids were transferred into A. rhizogenes strain R1000 by electroporation and grown at 28 °C on Luria-Bertani medium with kanamycin at a final concentration of 50 mg/L.

3.2. Establishment of Hairy Root Transformation

Excised cotyledons of P. grandiflorum from 12-day-old seedlings were used as explants for co-cultivation with A. rhizogenes strain R1000 that harbored AtPAP1 over-expression constructs. A similar pK7FWG2 vector with a CaMV 35S promoter-GUS fusion and the NPTII gene as a selectable marker was used as a control. The transformation of P. grandiflorum using A. rhizogenes was carried out as previously described by our group [19]. Hairy roots that were induced on plates containing 75 mg/L of kanamycin were examined by PCR with primers for the NPTII (kanamycin resistance) gene and rol genes (data not shown). Approximately 100 mg of different hairy root lines that had confirmed integration of over-expression were transferred to 30 mL of 1/2 Murashige and Skoog liquid medium in 100 mL flasks. Hairy root cultures were maintained at 25 °C on a gyratory shaker (100 rpm) in a growth chamber. Light was provided by standard cool white fluorescent tubes with a flux rate of 35 µmol s−1 m−2 and a 16 h photoperiod. After 3 weeks, hairy root samples were frozen in liquid nitrogen immediately after harvesting and then stored at −80 °C and/or freeze-dried for total RNA isolation and/or HPLC analysis.

3.3. RNA Isolation and cDNA Synthesis

Hairy root samples were ground into powder in a mortar with liquid nitrogen, and total RNA was isolated using a Plant Total RNA Mini kit (Geneaid, Sijhih, Taiwan) according to the manufacturer’s instructions. The quality and concentration of total extracted RNA was determined by 1% agarose gel electrophoresis and spectrophotometric analysis, respectively. For quantitative real-time PCR, 1 μg of total RNA was used for reverse transcription using the ReverTra Ace-R kit (Toyobo, Osaka, Japan), and a 20-fold dilution of the resulting 20 μL cDNA was used as template.

3.4. Quantitative Real-time PCR Analysis

Real-time PCR primers were designed using the Primer3 website [20] (http://frodo.wi.mit.edu/primer3/) and were based on the P. grandiflorum phenylalanine ammonia lyase (PAL1 and PAL2), cinnamate 4-hydroxylase (C4H), 4-coumarate CoA ligase (4CL), C3H, HCT, and HQT sequences, which were obtained as part of another study (unpublished sequences) [21], and AtPAP1 (Table 1). Real-time PCR products were tested for specificity of fragment sizes, melting curves, and sequences by PCR, real-time PCR, and cloning into a T-Blunt vector for sequencing, respectively. The expression of genes was calculated by relative quantification using the P. grandiflorum actin housekeeping gene (JF781303) as the reference. To quantify the standard, PCR products amplified from cDNA were purified, and the concentration of the products was measured in order to calculate the number of cDNA copies. Real-time PCR reactions were carried out in a 20 μL reaction mix containing 5 μL of template cDNA, 10 μL of 1× SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan), 0.5 μL of each primer (10 μM), and diethylpyrocarbonate water. Thermal cycling conditions were as follows: 95 °C for 5 min; 40 cycles of 95 °C for 15 s, 56 °C for 15 s, and 72 °C for 20 s. Each run contained a series of standards and a negative control (containing water instead of cDNA). PCR products were analyzed using Bio-Rad CFX Manager 2.0 software (Bio-Rad Laboratories, Hercules, CA, USA). Three replications for each sample were used in the real-time analyses.
Table 1. Primers used for quantitative real-time PCR.
Table 1. Primers used for quantitative real-time PCR.
PrimerSequence (5' to 3')Amplicon (Base Pairs)
PgPAL1_FCCACAACGTCACCCCTGTTT140
PgPAL1_RCATTAAGGACTTGCCCGGTT
PgPAL2_FAACCATAACATTACCCCATGCC146
PgPAL2_RGCAGCAGTAAGTGATTGTCCATCA
PgC4H_FCCTTTTGGTCCCTCACATGAAC175
PgC4H_RAGCCTCGACCTTGGACTCTTCT
Pg4CL_FCTTTGCCAAGGAACCATACGAG183
Pg4CL_RCTCTCAGTGGCCTCTGGATCAT
PgC3H_FCGATTATGGGCCTCATTATGTTA162
PgC3H_RCTCTTTCCCTCGTTATCAGGATT
PgHCT_FGGCTCGTGGACTCGATGTCA150
PgHCT_RGGACTGATTGAGCATTTGCAGG
PgHQT_FGAACGCCTCCGTTCAAAACA160
PgHQT_RGCGGCCAAGATCACGTAACTA
PgActin_FCCATACAGTCCCCATTTATGAAG170
PgActin_RGCTAACTTCTCCTTCATGTCTCTCA
AtPAP1_FAATGGCACCAAGTTCCTGTAAGA141
AtPAP1_RTATGAAGGCGAAGAAGAAGATCG

3.5. High-Performance Liquid Chromatography (HPLC) Analysis

The external standards for 3-(3,4-dihydroxycinnamoyl) quinic acid (CGA), were purchased from Extrasynthese (Genay, France). HPLC-grade methanol (MeOH) was purchased from Wako Pure Chemical Industries (Osaka, Japan). Formic acid and acetic acid were provided by Kanto Chemical Co., Inc. (Tokyo, Japan) and Junsei Chemical Co., Ltd. (Kyoto, Japan), respectively. For HPLC analysis, sample extracts were filtered through a 0.45 μm poly filter and then diluted 2-fold with MeOH prior to analysis. Samples were determined using a Futecs model NS-4000 HPLC apparatus (Daejeon, Korea) with a UV–vis detector and an auto sampler. The analysis was monitored at 280 nm and performed using a C18 column (250 mm × 4.6 mm × 5 μm; RStech, Daejeon, Korea); the mobile phase was a gradient prepared from mixtures of 0.15% acetic acid and methanol, and the column was maintained at 30 °C. The flow rate was set at 1.0 mL/min, and the injection volume was 20 μL. Quantification of CGA was based on peak areas and calculated as equivalents of representative standard compounds. All quantities are expressed as μg/100 mg of dry weight, and all samples were analyzed in triplicate.

4. Conclusions

This study demonstrates the successful metabolic engineering of CGA biosynthesis in hairy roots of P. grandiflorum through genetic modification with AtPAP1 using A. rhizogenes. Over-expression constructs of AtPAP1 are an effective method for enriching the formation of CGA. The establishment of transgenic hairy roots with rich CGA accumulation represents a novel and potential alternative source of P. grandiflorum roots for medicinal and commercial applications.

Acknowledgments

The authors thank Addiriyah Chair for Environmental Studies, Department of Botany and Microbiology, College of Science, King Saud University, Saudi Arabia for the support. The author Sang Un Park thanks the visiting professor program, Deanship of Scientific Research at King Saud University, Riyadh, Saudi Arabia.

Author Contributions

S.U.P. and N.I.P. planed the experiments and designed; P.A.T., N.I.P. and S.L. conducted experiments; D.Y.K., M.V.A. and N.A.A.-D. analyzed the data; P.A.T. and S.U.P. wrote the paper.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Abdulrazzak, N.; Pollet, B.; Ehlting, J.; Larsen, K.; Asnaghi, C.; Ronseau, S.; Proux, C.; Erhardt, M.; Seltzer, V.; Renou, J.P. A coumaroyl-ester-3-hydroxylase insertion mutant reveals the existence of nonredundant meta-hydroxylation pathways and essential roles for phenolic precursors in cell expansion and plant growth. Plant Physiol. 2006, 140, 30–48. [Google Scholar] [CrossRef]
  2. Rice-Evans, C.A.; Miller, N.J.; Paganga, G. Structure-antioxidant activity relationship of flavonoids and phenolic acids. Free Radic. Biol. Med. 1996, 20, 933–956. [Google Scholar]
  3. Clifford, M.N.; Knight, S.; Surucu, B.; Kuhnert, N. Characterization by LC–MS (n) of four new classes of chlorogenic acids in green coffee beans: Dimethoxycinnamoylquinic acids, diferuloylquinic acids, caffeoyl-dimethoxycinnamoylquinic acids, and feruloyl-dimethoxycinnamoylquinic acids. J. Agric. Food Chem. 2006, 54, 1957–1969. [Google Scholar] [CrossRef]
  4. Niggeweg, R.; Michael, A.J.; Martin, C. Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat. Biotechnol. 2004, 22, 746–754. [Google Scholar] [CrossRef]
  5. Comino, C.; Lanteri, S.; Portis, E.; Acquadro, A.; Romani, A.; Hehn, A.; Larbat, R.; Bourgaud, F. Isolation and functional characterization of a cDNA coding a hydroxycinnamoyltransferase involved in phenylpropanoid biosynthesis in Cynara cardunculus L. BMC Plant Biol. 2007, 7, 14. [Google Scholar] [CrossRef]
  6. Lepelley, M.; Cheminade, G.; Tremillon, N.; Simkin, A.; Caillet, V.; McCarthy, J. Chlorogenic acid synthesis in coffee: An analysis of CGA content and real-time RT-PCR expression of HCT, HQT, C3H1, and CCoAOMT1 genes during grain development in C. canephora. Plant Sci. 2007, 172, 978–996. [Google Scholar] [CrossRef]
  7. Qiu, J.; Gao, F.; Shen, G.; Li, C.; Han, X.; Zhao, Q.; Zhao, D.; Hua, X.; Pang, Y. Metabolic engineering of the phenylpropanoid pathway enhances the antioxidant capacity of Saussurea involucrata. PLoS One 2013, 8, e70665. [Google Scholar] [CrossRef]
  8. Tohge, T.; Nishiyama, Y.; Hirai, M.Y.; Yano, M.; Nakajima, J.-I.; Awazuhara, M.; Inoue, E.; Takahashi, H.; Goodenowe, D.B.; Kitayama, M. Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor. Plant J. 2005, 42, 218–235. [Google Scholar] [CrossRef]
  9. Borevitz, J.O.; Xia, Y.; Blount, J.; Dixon, R.A.; Lamb, C. Activation tagging identifies a conserved MYB regulator of phenylpropanoid biosynthesis. Plant Cell 2000, 12, 2383–2394. [Google Scholar] [CrossRef]
  10. Zhao, H.L.; Harding, S.V.; Marinangeli, C.P.E.; Kim, Y.S.; Jones, P.J.H. Hypocholesterolemic and anti-obesity effects of saponine from Platycodon grandiflorum in hamsters fed atherogenic diets. J. Food Sci. 2008, 73, H195–H200. [Google Scholar]
  11. Zheng, J.; He, J.; Ji, B.; Li, Y.; Zhang, X. Antihyperglycemic effects of Platycodon grandiflorum (Jacq.) A. DC—Extract on streptozotocin-induced diabetic mice. Plant Foods Hum. Nutr. 2007, 62, 7–11. [Google Scholar]
  12. Choi, J.H.; Yoo, K.Y.; Park, O.K.; Lee, C.H.; Won, M.H.; Hwang, I.K.; Ryu, S.Y.; Kim, Y.S.; Yi, J.S.; Bae, Y.S.; et al. Platycodin D and 2'-o-acetyl-polygalacin D2 isolated from Platycodon grandiflorum protect ischemia/reperfusion injury in the gerbil hippocampus. Brain Res. 2009, 1279, 197–208. [Google Scholar] [CrossRef]
  13. Lee, J.Y.; Yoon, J.W.; Kim, C.T.; Lim, S.T. Antioxidant activity of phenylpropanoid esters isolated and identified from Platycodon grandiflorum A. DC. Phytochemistry 2004, 65, 3033–3039. [Google Scholar]
  14. Sharma, P.; Padh, H.; Shrivastava, N. Hairy root cultures: A suitable biological system for studying secondary metabolic pathways in plants. Eng. Life Sci. 2013, 13, 62–75. [Google Scholar] [CrossRef]
  15. Howles, P.A.; Sewalt, V.; Paiva, N.L.; Elkind, Y.; Bate, N.J.; Lamb, C.; Dixon, R.A. Overexpression of l-phenylalanine ammonia-lyase in transgenic tobacco plants reveals control points for flux into phenylpropanoid biosynthesis. Plant Physiol. 1996, 112, 1617–1624. [Google Scholar]
  16. Luo, J.; Butelli, E.; Hill, L.; Parr, A.; Niggeweg, R.; Bailey, P.; Weisshaar, B.; Martin, C. AtMYB12 regulates caffeoyl quinic acid and flavonol synthesis in tomato: Expression in fruit results in very high levels of both types of polyphenol. Plant J. 2008, 56, 316–326. [Google Scholar] [CrossRef]
  17. Vogt, T. Phenylpropanoid biosynthesis. Mol. Plant 2010, 3, 2–20. [Google Scholar] [CrossRef]
  18. Karimi, M.; Bleys, A.; Vanderhaeghen, R.; Hilson, P. Building blocks for plant gene assembly. Plant Physiol. 2007, 145, 1183–1191. [Google Scholar] [CrossRef] [Green Version]
  19. Park, N.I.; Tuan, P.A.; Li, X.; Kim, Y.K.; Yang, T.J.; Park, S.U. An efficient protocol for genetic transformation of Platycodon grandiflorum with Agrobacterium rhizogenes. Mol. Biol. Rep. 2011, 38, 2307–2313. [Google Scholar] [CrossRef]
  20. Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef]
  21. Tuan, P.A.; Li, X.; Park, N.I.; Park, S.U. Molecular cloning and characterization of chlorogenic acid biosynthetic genes in Platycodon grandiflorum. Manuscript in preparation. 2014. [Google Scholar]

Share and Cite

MDPI and ACS Style

Tuan, P.A.; Kwon, D.Y.; Lee, S.; Arasu, M.V.; Al-Dhabi, N.A.; Park, N.I.; Park, S.U. Enhancement of Chlorogenic Acid Production in Hairy Roots of Platycodon grandiflorum by Over-Expression of An Arabidopsis thaliana Transcription Factor AtPAP1. Int. J. Mol. Sci. 2014, 15, 14743-14752. https://doi.org/10.3390/ijms150814743

AMA Style

Tuan PA, Kwon DY, Lee S, Arasu MV, Al-Dhabi NA, Park NI, Park SU. Enhancement of Chlorogenic Acid Production in Hairy Roots of Platycodon grandiflorum by Over-Expression of An Arabidopsis thaliana Transcription Factor AtPAP1. International Journal of Molecular Sciences. 2014; 15(8):14743-14752. https://doi.org/10.3390/ijms150814743

Chicago/Turabian Style

Tuan, Pham Anh, Do Yeon Kwon, Sanghyun Lee, Mariadhas Valan Arasu, Naif Abdullah Al-Dhabi, Nam Il Park, and Sang Un Park. 2014. "Enhancement of Chlorogenic Acid Production in Hairy Roots of Platycodon grandiflorum by Over-Expression of An Arabidopsis thaliana Transcription Factor AtPAP1" International Journal of Molecular Sciences 15, no. 8: 14743-14752. https://doi.org/10.3390/ijms150814743

Article Metrics

Back to TopTop