Int. J. Mol. Sci. 2012, 13(8), 9527-9533; doi:10.3390/ijms13089527

Short Note
Isolation and Characterization of Microsatellite Markers in Brown Planthopper (Nilaparvata lugens Stål)
Shengli Jing , Xi Zhou , Hangjin Yu , Bingfang Liu , Chunxiao Zhang , Shuzhen Wang , Xinxin Peng , Lili Zhu , Yi Ding and Guangcun He *
State Key Laboratory of Hybrid Rice, College of Life Science, Wuhan University, Wuhan 430072, Hubei Province, China; E-Mails: jsl80@163.com (S.J.); cathychou@whu.edu.cn (X.Z.); yhj@whu.edu.cn (H.Y.); bingfangliu@163.com (B.L.); emilyat10@126.com (C.Z.); wangshuzhen04@163.com (S.W.); fred_pxx@126.com (X.P.); zhulili58@sina.com (L.Z.); yiding@whu.edu.cn (Y.D.)
*
Author to whom correspondence should be addressed; E-Mail: gche@whu.edu.cn; Tel.: +86-27-6875-2384; Fax: +86-27-6875-2327.
; in revised form: 22 June 2012 / Accepted: 16 July 2012 /
Published: 27 July 2012

Abstract

: Brown planthopper (Nilaparvata lugens Stål) (Homoptera: Delphacidae) is an economically important pest on rice. In this study, 30 polymorphic microsatellite markers were developed from N. lugens genomic libraries using the method of Fast Isolation by AFLP of Sequence Containing Repeats (FIASCO). Polymorphism of each locus was detected in 48 individuals from two natural populations. These microsatellite loci revealed 2 to 18 alleles, and the expected and observed heterozygosities ranged from 0.042 to 0.937 and from 0.042 to 0.958, respectively. These markers will be useful for the future study of this agricultural pest in population genetics and molecular genetics.
Keywords:
Nilaparvata lugens; microsatellites; polymorphism; genetic diversity

1. Introduction

Brown planthopper (Nilaparvata lugens Stål) (Homoptera: Delphacidae) is a specialist insect pest of rice which does great damage to the rice plants not only directly by consuming the plants sap but also indirectly by transmitting rice viruses such as ragged stunt virus or grassy stunt virus. Many Asia rice-producing countries are frequently reported to have suffered significant damage and heavy yield losses due to brown planthopper [1]. Moreover, brown planthoppers are found to have adapted to the variety of host rice and formed new populations, which can break host plant’s resistance [2]. Therefore, it is important to study the population ecology and evolution of this pest. SSR, with advantages of multi-allelic behavior, co-dominance, abundance and high information content, have been developed for many species [3]. So far, the EST-SSR markers of brown planthopper have been developed for studying genetic diversity of the natural populations [4,5] and the experimental populations [6]. In general, genomic SSR markers are more polymorphic than EST-SSRs. In this study, we have developed and characterized another 30 genomic SSR markers for N. lugens.

2. Results and Discussion

A total of 136 primer pairs were designed from microsatellite sequences isolated from partial genome libraries by a standard Fast Isolation by AFLP of Sequence Containing Repeats (FIASCO) protocol. Out of them, sixty-two successfully yielded clear bands while the others showed multi-banding patterns or no amplification. Then, these primers were further tested in two natural populations of N. lugens collected from Wuhan, Hubei Province (Wuhan population) and Wuyishan, Fujian Province (Wuyishan population), respectively. Among them, 30 markers showed polymorphism between these two populations (Table 1); and the amplification products are within the expected size range.

It was found that the degree of polymorphism between two populations was not significantly different. The average number of detected alleles per locus and the mean observed heterozygosity for two populations were also similar. In the Wuhan population of N. lugens, the numbers of detected alleles per locus in 24 individuals ranged from 2 to 16, with an average of 9.2 alleles for the 30 markers. The expected and observed heterozygosities ranged from 0.042 to 0.910 (mean 0.717) and from 0.042 to 0.958 (mean 0.515), respectively (Table 2). The degree of polymorphism of BM1373 was the highest in the Wuhan population. Twenty-one loci (BM1362, BM1368, BM1369, BM1375, BM1377, BM1378, BM1392, BM1393, BM1417, BM1422, BM1423, BM1432, BM1433, BM1443, BM1446, BM1456, BM1462, BM1464, BM1472, BM1486 and BM1490) deviated significantly from HWE (p < 0.05) due to heterozygote deficiency, and null alleles were found in these loci except two (BM1362 and BM1486).

In the Wuyishan population, the numbers of detected alleles per locus in 24 individuals ranged from 2 to 18, with an average of 9.3 alleles per locus. The expected and observed heterozygosities ranged from 0.191 to 0.937 (mean 0.717) and from 0.042 to 0.875 (mean 0.530), respectively. The degree of polymorphism of BM1373 was also the highest in the Wuyishan population. Eighteen loci (BM1368, BM1369, BM1372, BM1375, BM1378, BM1392, BM1393, BM1417, BM1418, BM1422, BM1422, BM1432, BM1433, BM1446, BM1456, BM1471, BM1472 and BM1490) deviated significantly from HWE (p < 0.05) due to heterozygote deficiency, and null alleles were found in these loci except three (BM1417, BM1418 and BM1456).

The statistical significance of the linkage disequilibrium among 30 microsatellite loci was tested by Fisher’s exact probability test. Linkage disequilibrium p-values were obtained for 435 pairs of marker combinations. Out of these, 79 (18.2%) pairs in the Wuhan population and 91 (20.9%) pairs in the Wuyishan population, showed significant LD at p < 0.05, respectively.

Genomic SSR markers appear to be more polymorphic in this study. Both the number of alleles and the observed heterozygosity of genomic SSR dataset are higher than those of two EST-SSR datasets [5,6]. In Liu and Hou’s study, the number of alleles ranged from two to five, and the observed heterozygosity ranged from 0.111 to 0.411. In Jing’s study, the number of alleles ranged from two to seven, and the average observed heterozygosity for four populations ranged from 0.43 to 0.52. In this study, these microsatellite loci revealed 2 to 18 alleles, and the observed heterozygosities ranged from 0.042 to 0.958. Therefore, these microsatellite loci are better than EST-SSRs for genetic diversity study and the construction of linkage map of N. lugens.

The observed heterozygosity was lower than the expected heterozygosity in all loci except seven (BM1415, BM1420, BM1476 and BM1483 in both populations; BM1372, BM1373 and BM147 in the Wuyishan population). Several factors may lead to the observed heterozygosity being less than expected heterozygosity in a population, such as the presence of null alleles and sex-linkage that are two aspects of great importance for explaining the disequilibrium of HW. In this study, the null alleles were present in many loci, while the evidence of sex was not found because only female adults were used. Therefore, further investigation for these two factors is needed in future studies, especially for the sex-like loci.

3. Experimental Section

The genomic DNA was extracted from a female individual of N. lugens with a CTAB protocol [7]. The (AC)13 and (AAG)8-enriched partial genomic libraries were constructed, employing a AFLP (amplified fragment length polymorphism) of sequences containing repeats (FIASCO) protocol [8]. Fragments containing microsatellite repeats were cloned into pUC18-T vector (TaKaRa) and transformed into TOP10 cells. Finally, 219 positive clones with suitable insert length were identified and sequenced using an ABI 3730 DNA sequencer.

189 sequences were obtained and screened for the SSR motifs using the SSRIT discover program [9]. As a result, 87 sequences contained at least one microsatellite locus, and 136 primer pairs were designed by using BatchPrimer3 [10]. For all PCR amplifications, we used a PTC-100 thermal cycler (MJ Research) and performed in 10 μL volumes containing 10 ng of template DNA, 0.3 μM of each of the two primers, 0.2 mM deoxynucleotide triphosphates (dNTPs), 2.5 mM MgCl2, 1 × PCR buffer, and 1 unit of Taq DNA polymerase (Fermentas). The PCR cycling program, in each case, was 94 °C for 5 min, followed by 35 cycles of 94 °C for 15 s, 55 °C for 15 s, and 72 °C for 30 s, with a final extension step of 72 °C for 10 min. PCR amplification products were size-fractionated by electrophoresis on 6% denaturing polyacrylamide sequencing gels that were run at a constant power of 60 W, and then detected by silver staining [11]. Allele sizes were scored by comparison with pBR322 DNA/MspI DNA size markers (Tiangen Biotech).

The level of polymorphism was determined for 48 female adults from two populations of N. lugens collected from rice fields in Wuhan, Hubei Province and in Wuyishan, Fujian Province, China. For each locus, the number of alleles (Na), observed heterozygosity (Ho), expected heterozygosity (He), tests for linkage disequilibrium (LD) and deviations from Hardy-Weinberg equilibrium (HWE) were calculated by the software Arlequin 3.1 [12]. The occurrence of a null allele was estimated by the software MICRO-CHECKER [13].

4. Conclusions

In summary, 30 microsatellite markers have been developed from Nilaparvata lugens, and reveal a high degree of polymorphism among individuals in two natural populations. These markers are useful for population genetic diversity and molecular genetics study of this agricultural pest.

Acknowledgment

This work was supported by the Fundamental Research Funds for the Central Universities of China (grant number 114050).

References

  1. Bentur, J.S.; Viraktamath, B.C. Rice planthoppers strike back. Curr. Sci 2008, 95, 441–443.
  2. Pathak, M.D. Utilization of Insect-Plant Interactions in Pest Control. In Insects, Science and Society; Pimentel, D., Ed.; Academic Press: London, UK, 1975; pp. 121–148.
  3. Powell, W.; Machray, G.C.; Provan, J. Polymorphism revealed by simple sequence repeats. Trends Plant Sci 1996, 1, 215–222.
  4. Sun, J.T.; Zhang, Y.K.; Ge, C.; Hong, X.Y. Mining and characterization of sequence tagged microsatellites from the brown planthopper Nilaparvata lugens. J. Insect Sci 2011, 11, 1–11.
  5. Liu, Y.D.; Hou, M.L. Development of EST-SSRs in the brown planthopper Nilaparvata Lugens. In permanent genetic resources added to molecular ecology resources database 1 January 2009–30 April 2009. Mol. Ecol. Resour 2009, 9, 1375–1429.
  6. Jing, S.L.; Liu, B.F.; Peng, L.; Peng, X.X.; Zhu, L.L.; Qiang, F.; He, G.C. Development and use of EST-SSR markers for assessing genetic diversity in the brown planthopper (Nilaparvata lugens Stål). Bull. Entomol. Res 2012, 102, 113–122.
  7. Tang, M.; Lv, L.; Jing, S.L.; Zhu, L.L.; He, G.C. Bacterial symbionts of the brown planthopper, Nilaparvata lugens (Homoptera: Delphacidae). Appl. Environ. Microbiol 2010, 76, 1740–1745.
  8. Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16.
  9. Gramene Ssrtool. Available online: http://www.gramene.org/db/markers/ssrtool , accessed on 28 July 2005.
  10. You, F.M.; Huo, N.; Gu, Y.Q.; Luo, M.C.; Ma, Y.; Hane, D.; Lazo, G.R.; Dvorak, J.; Anderson, O.D. BatchPrimer3: A high throughput web application for PCR and sequencing primer design. BMC Bioinforma 2008, 9, doi:10.1186/1471-2105-9-253. http://www.biomedcentral.com/pubmed/18510760.
  11. Han, Y.C.; Teng, C.Z.; Hu, Z.L.; Song, Y.C. An optimal method of DNA silver staining in polyacrylamide gels. Electrophoresis 2008, 29, 1355–1358.
  12. Excoffier, L.; Laval, G.; Schneider, S. Arlequin ver. 3.0: An integrated software package for population genetics data analysis. Evol. Bioinforma. Online 2005, 1, 47–50.
  13. Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538.
Table 1. Characteristics of 30 new microsatellite markers developed in Nilaparvata lugens.

Click here to display table

Table 1. Characteristics of 30 new microsatellite markers developed in Nilaparvata lugens.
LocusRepeat motifPrimer sequence (5′–3′)GenBank accession No.
BM1362(AAGT)3F: TGGGCAAGACCATCTTGATA
R: CGAATTCAAATGGGAAGTCTGT
JQ967334
BM1368(AG)10F: AGGGATTCAGATTCAGGGAGA
R: CGGTGGAGATGAAAGTGGAC
JQ967337
BM1369(AG)9F: TCGTGCAGAAGCGAAAGAAT
R: TTTTTCAACTCGTCAGCATGT
JQ967338
BM1372(AT)6F: GTGCAACCACGAGCATTTC
R: AAGACCCCTTCCTCAGCATC
JQ967341
BM1373(CT)7F: CCACATTCCACCTCTTTTCA
R: AGTGCGCAGAAACTTGATGA
JQ967340
BM1375(GA)8F: TCCATGAGAAAGAGGGCTTG
R: GCTGAGGCCTTACCTATCAAA
JQ967346
BM1377(CTT)4F: TACACTAACGCACGCACACA
R: TCAACGGTAAAGGGAGAAGG
JQ967347
BM1378(TG)7F: CATCATTGCAACGTTCATCC
R: GCCCTCCAAATTAGGTCTCC
JQ967348
BM1392(AAG)4F: GAAGCTGAAAAAGAAAGATGAAGAA
R: TTTGCCTCAATTTTGCTCCT
JQ967349
BM1393(CCT)5F: ACCTCTCCCCCTCATCATTC
R: TGGTTTGGTGTTCGATGCTA
JQ967350
BM1415(TC)6F: CGGTCCAAAAATGGAAAATG
R: GGGTGTGTGCCATGATTTAG
JQ967360
BM1417(TGAA)3F: TGAGTTGGAAGGTGTCATGG
R: TCCTCAATGGACCTCTCTCCT
JQ967353
BM1418(ATG)5F: GAAAGAAAATGGAGCCGTCA
R: ACCCATGCCTCTTTCCTCTT
JQ967354
BM1420(GAAG)3F: GAAACTTGGTGAGGGGATCA
R: TTCTTTGTTCACAATTTTCTCAGC
JQ967342
BM1422(GA)6F: TAAGGCGAGAAAGTGCGATT
R: CTTTCTCCCACTTCCCCATC
JQ967343
BM1423(GAT)6F: GGAGGAGGTCGAGGAAGAAT
R: TCCTCCATTCCTTCTTCTTGTT
JQ967344
BM1432(GA)7F: GTGACAAAGAGCGAGGGAGT
R: CGCCCTAACTTACCCTGCTA
JQ967335
BM1433(AG)8F: TGCAGAGAGATGAGGCAAAA
R: TTTCGCACAACGTACTGCTC
JQ967336
BM1437(TCAA)3F: CAAACAATAGCGAGCATTACAGA
R: CCAGCGTTATTGTCCTGTCA
JQ967339
BM1443(GATT)4F: TCCTTCCCATCAATACAAGACC
R: TCAAGCCCTCTTTCTCATGG
JQ967346
BM1446(TC)11F: TTTGTCGGAGCGATCTCTTT
R: CGCTGTCCATTCAACAAATG
JQ967345
BM1456(TAA)5F: TGGAAGTGAAACTGCAAGAAAA
R: TTGCGACCTGAAAACTCTGA
JQ967357
BM1462(AAG)12F: GTCCGGGCTTAGCCTTTTAT
R: GCATCTAACGGGTGATTCTCA
JQ967351
BM1464(AG)7F: CATTCACAGCTGAGGTATGAGG
R: CACAGCTTGACTCACCCTCTC
JQ967359
BM1471(AAG)4F: CGAAGCGGAAATAGATGGTT
R: CACATTTTCCAGGCTTCACC
JQ967355
BM1472(GAA)7F: GGGAAGGGGAGAAGTCAAAG
R: CATTCCACCTCCTTCTTCCA
JQ967358
BM1476(GAAGGA)4F: CGACGGAAAATCAGTCATCA
R: CCTGCTTCACATCCTCCTTC
JQ967356
BM1483(AAT)4F: GCGTTTGAGCGTGGTTTCTA
R: ATGGAGTGGGTCCACCAATA
JQ967352
BM1486(AAG)5F: AAAAATGGATGGGAAAGGAGA
R: CCTTCCATCCTTTTATTCTTCTCA
JQ967354
BM1490(GT)11F: GTCAAATCCCTGGCACATTT
R: TGAAGTGAATGAAACCCACATC
JQ967344
Table 2. Diversity estimation in two populations of Nilaparvata lugens.

Click here to display table

Table 2. Diversity estimation in two populations of Nilaparvata lugens.
LocusPopulation WH (n = 24)
Population WYS (n = 24)
NaHoHeDSNaHoHeDS
BM136240.2920.393*232–24650.2920.425NS232–252
BM136890.3910.844*130–162100.2920.544*138–168
BM1369110.6670.877*182–20890.4090.819*186–308
BM137220.0420.042NS200–20420.0420.191*200–204
BM1373150.9580.902NS110–152160.8750.928NS116–172
BM1375110.5830.853*180–206120.6250.886*180–238
BM137790.4580.732*194–22460.5420.722NS187–232
BM1378120.3750.883*192–240180.4090.937*168–240
BM1392130.5420.766*148–280150.5450.814*130–250
BM139350.2500.527*186–246100.3750.707*186–246
BM141570.7080.701NS192–21270.5420.448NS180–216
BM141730.2730.588*180–20040.4580.621*180–204
BM141890.5830.689NS164–19480.5420.743*164–194
BM142060.2920.270NS212–26040.4780.467NS200–260
BM1422100.5000.853*182–206130.5650.921*178–204
BM1423130.6520.909*217–320130.6360.874*220–379
BM1432150.7390.910*130–218120.2610.875*140–218
BM1433120.5650.898*184–250130.5910.906*186–244
BM143770.5000.505NS182–23060.5650.593NS174–230
BM1443110.3480.750*168–24070.5420.588NS160–202
BM1446160.6520.907*164–254130.6090.891*170–254
BM1456100.4580.828*140–22050.5000.582*180–260
BM1462120.7390.901*179–260110.7920.855NS179–216
BM146450.5000.739*182–28040.5560.743NS182–280
BM147140.6820.601NS201–25240.3000.750*198–252
BM1472120.3330.895*161–238150.5650.919*138–260
BM147660.5000.429NS180–22280.8180.648NS180–240
BM148380.7080.679NS204–243100.8100.724NS207–261
BM148660.5830.736*190–21770.6670.707NS190–262
BM1490140.5830.902*184–238120.7080.887*176–210
Mean9.20.5150.717--9.30.5300.724--

N: population sample size; HO: observed heterozygosity; He: expected heterozygosity; Na: number of alleles; D: deviation from Hardy-Weinberg equilibrium; S: Size range (bp); NS: not significant;*significant deviations from Hardy-Weinberg expectations (p < 0.05); Population WH: Wuhan population; Population WYS: Wuyishan population.

Int. J. Mol. Sci. EISSN 1422-0067 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert