Next Article in Journal
A Chitosan Induced 9-Lipoxygenase in Adelostemma gracillimum Seedlings
Previous Article in Journal
Biodegradable Nanoparticles of mPEG-PLGA-PLL Triblock Copolymers as Novel Non-Viral Vectors for Improving siRNA Delivery and Gene Silencing

Int. J. Mol. Sci. 2012, 13(1), 534-539; doi:10.3390/ijms13010534

Short Note
A Set of Novel Microsatellite Markers Developed for Luculia yunnanensis (Rubiaceae), an Endangered Plant Endemic to Yunnan, China
Hong Ma 1, Lan Wang 2, Youming Wan 1, Hongzhe Li 3, Zhenghong Li 1,*, Xiuxian Liu 1, Ning Liang 1 and Wenjuan Li 1
1
Research Institute of Resource Insects, Chinese Academy of Forestry, Kunming 650224, China; E-Mails: mahongmh@gmail.com (H.M.); wanyouming@126.com (Y.W.); lxx205@126.com (X.L.); ln417@126.com (N.L.); hanbing2587cn@yahoo.com.cn (W.L.)
2
Yunnan Reascend Tobacco Technology (Group) Co., Ltd., Kunming 650106, China; E-Mail: lwang0124@gmail.com
3
Faculty of Traditional Chinese Pharmacy, Yunnan University of Traditional Chinese Medicine, Kunming 650500, China; E-Mail: lihongzheyn@163.com
*
Author to whom correspondence should be addressed; E-Mail: hortscience@163.com; Tel.: +86-871-3860032; Fax: +86-871-3860027.
Received: 31 October 2011; in revised form: 23 December 2011 / Accepted: 28 December 2011 /
Published: 4 January 2012

Abstract

: The genus Luculia Sweet contains about five species of small trees or shrubs and is a member of the family Rubiaceae (tribe Cinchoneae). Luculia yunnanensis is an endangered ornamental shrub endemic to southwest China. Only two natural populations of L. yunnanensis exist in the wild according to our field investigation. It can be inferred that L. yunnanensis is facing a very high risk of extinction in the wild and an urgent conservation strategy is required. By using a modified biotin-sterptavidin capture method, 24 primer sets were identified in two wild populations. Of these primers, 11 displayed polymorphisms and 13 were monomorphic. The number of alleles per locus ranged from two to four, values for observed and expected heterozygosities ranged from 0.000 to 0.833 and from 0.431 to 0.771, with averages of 0.389 and 0.614, respectively. These markers will be useful for further investigation of conservation of resources, selecting parental types in cross-breeding, evolution of this species at the molecular level and related research in Luculia species.
Keywords:
genetic diversity; Luculia yunnanensis; microsatellite marker; polymorphism; population structure; Rubiaceae

1. Introduction

The genus Luculia Sweet contains about five species of small trees or shrubs and is a member of the family Rubiaceae (tribe Cinchoneae) [1]. It can be easily recognized by its beautiful pink, sweetly fragrant and long-term blooming time flowers, and therefore has been horticulturally introduced into various regions and botanical gardens around the world. Three Luculia species exist in China; among them L. yunnanensis Hu is the unique one which is endemic to Yunnan Province, naturally confined to forests or thickets on limestone mountains, open slopes and secondary shrubby woodland at an altitude of between 1200 and 3200 m [2]. It is a typical distylous species with reciprocally placed stigma and anthers in each floral morph [3]. Nevertheless, our continued field investigations showed that it is now difficult to find wild populations as appropriate habitats have been fragmented due to human activities.

Considering its high ornamental value, endemism and endangered status, we developed 24 microsatellite markers from L. yunnanensis to obtain its genetic information for further studies on conservation of resources, selecting parental types in cross-breeding, as well as evolution of this species at the molecular level.

2. Results and Discussion

A total of 317 putative SSR-positive clones were captured, among these 165 clones (52%) were found to contain simple sequence repeats (SSR). Finally, 48 sequences contained SSR loci were selected for primer design. Twenty-four microsatellite loci successfully amplified in L. yunnanensis for 48 microsatellite loci and 11 of them were polymorphic amplification, other 13 microsatellite loci were monomorphic by the result of polyacrylamide gel (Table 1).

The number of alleles ranged from two to four in 24 individuals of the species sampled from the two natural populations. Values for HO and HE ranged from 0.000 to 0.833 and from 0.431 to 0.771, with averages of 0.389 and 0.614, respectively (Table 2).

These microsatellite markers developed in our study will be a useful tool for further studies of conservation genetics, and will help us understand the genetic structure of L. yunnanensis, so as to make effective conservation strategy for this endangered plant.

3. Experimental Section

Genomic DNA samples of L. yunnanensis were extracted from silica-gel-dried leaves using a modified CTAB methodology [4]. The extracted DNA was dissolved in 30 μL TE buffer. A microsatellite enriched library was then conducted using a modified biotin-streptavidin capture method [5]. Total genomic DNA (approximate 250–400 ng) was completely digested with 2.5 U of MseI restriction enzyme (New England Biolabs, Beverly, MA, USA), and then ligated to an MseI AFLP adaptor (5′-TAC TCA GGA CTC AT-3′/5′-GAC GAT GAG TCC TGA G-3′) using T4 DNA ligase (New England Biolabs, Beverly, MA, USA). The digested-ligated fragments were diluted in a ratio of 1:10, and 5 μL of them were used amplification reaction with adaptor-specific primers (5′-GAT GAG TCC TGA GTA AN-3′/5′-TTA CTC AGG ACT CAT CN-3′). The amplified DNA fragments (200–800 bp) were enriched by magnetic bead selection with a 5-biotinylated [(AG)15, (AAG)10 and (AC)15] probe, respectively [6]. The Recovered DNA fragments were reamplified with MseI-N primers. The purified PCR products using EZNA Gel Extraction Kit (Omega Bio-Tek, Guangzhou, China), were ligated into pMD18-T vector (Takara, Dalian, Liaoning, China), and then transformed into DH5a competent cells (Tiangen, Beijing, China). The positive clones were tested using vector primers T3/T7 and primer (AC)10/(AG)10/(AAG)7 respectively. All these PCR reactions had the same conditions: 95 °C for 3 min followed by 32 cycles at 94 °C for 45 s, 52 °C for 1 min, 72 °C for 1 min, and a final extension step at 72 °C for 10 min. The positive clones were captured for sequencing with an ABI PRISM 3730XL DNA sequencer (Applied Biosystems, Foster City, CA, USA). Sequences contained simple sequence repeat and enough flanking regions were selected for primer design using Primer Premier 5.0 program [7].

The designed Primer pairs were tested in 24 wild individuals of L. yunnanensis from two natural populations collected in Southwest China: population 1 (Lushui County, 26°29'N, 98°50'E, 1772a.s.l.) and population 2 (Fugong County, 25°58'N, 98°47'E, 1884a.s.l.). Herbarium voucher deposited in Kunming Institute of Botany, Chinese Academy of Sciences. The PCR amplification was carried out in a total volume of 20 μL reaction containing 10 μL 2 × Taq PCR MasterMix (Tiangen; 0.1 U Taq Polymerase/μL, 0.5 mM dNTP each, 20 mM Tris-HCl (Ph 8.3), 100 mM KCl, 3 mM MgCl2), 0.5 μL of each primer and 50–100 ng Genomic DNA. PCR amplifications were conducted under the following conditions: 95 °C for 5 min followed by 32–35 cycles at 94 °C for 45 s, at the annealing temperature for each specific primer (optimized for each locus, Table 1) for 45 s, 72 °C for 1 min, and a final extension step at 72 °C for 10 min. PCR products were separated on 8% polyacrylamide denaturing gel using a 20 bp ladder molecular size standard by silver staining.

The data was analyzed by GENEPOP 4.0 [8], which included test of observed heterozygosity (HO) and expected heterozygosity (HE) for the 11 polymorphic microsatellite loci.

4. Conclusions

In summary, 24 microsatellite markers have been specifically developed for L. yunnanensis in this study. These markers will facilitate further studies on the population genetics of L. yunnanensis and its allied species. They are also expected to be useful for parental selections in controlled hybridization breeding programs and enable us to protect sources of germplasm through genetic diversification via ex situ nurseries and reintroduction programs.

Acknowledgements

This work was supported by the Special Fund of Basic Research of Central Nonprofit Research Institutes (Riricaf 201003M).

References

  1. Chen, W.Q. Flora of Yunnan (Chinese Version); Science Press: Beijing, China, 2003; Volume 15, p. 20. [Google Scholar]
  2. Luo, X.R.; Gao, W.Z.; Chen, W.Q.; Xu, X.H.; Wu, H. Flora of China (Chinese Version); Science Press: Beijing, China, 1999; Volume 71, p. 238. [Google Scholar]
  3. Zhou, W.; Wang, H.; Li, D.Z.; Yang, J.B. Isolation and characterization of 13 microsatellite loci from Luculia pinceana (Rubiaceae), a typical distylous species. Hortscience 2010, 45, 840–841. [Google Scholar]
  4. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of leaf tissue. Phytochem. Bull 1987, 19, 11–15. [Google Scholar]
  5. Chen, T.; Zhou, R.C.; Ge, X.J.; Shi, S. Development and characterization of microsatellite markers for a mangrove tree species Sonneratia caseolaris (L.) Engler (Lythraceae sensu lato). Conserv. Genet 2008, 9, 957–959. [Google Scholar]
  6. Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
  7. Clarke, K.R.; Gorley, R.N. PRIMER (Version 5): User Manual/Tutorial; PRIMER-E: Plymouth, UK, 2001; p. 91. [Google Scholar]
  8. Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
Table Table 1. Characteristics of 24 microsatellite loci successfully amplified in Luculia yunnanensis.

Click here to display table

Table 1. Characteristics of 24 microsatellite loci successfully amplified in Luculia yunnanensis.
LocusPrimer sequence (5′-3′)Repeat motifSize (bp)Ta (°C)GenBank Accession No.
MH 01 *F: GCACTGGCTTAGTTCTTT
R: TGTTTGTCTCAGGGGTAT
(CT)12(CCCT)3(CT)421360JN871296
MH 02 *F: AAACGAGCAGAAACTGGA
R: GCATTGTCCAACCCTTTA
(TG)11(AG)915360JN871297
MH 03 *F: CAACTTCCCAAATTCTGC
R: TACCCAACACTTTCTCACCA
(CT)1632261JN871298
MH 04 *F: TTTCATTCCGTAACCTT
R: GCCAAAAACTTGTATAATTC
(CT)3319857JN871299
MH 05 *F: TCGTACAATTTTGTTGCTCT
R: CATTCCTCAATAAACCCATA
(TG)1213061JN871300
MH 06 *F: CTCTATCTGTCGCATTCTTC
R: TCTAGTAATACTATCCTCCACC
(TC)1920161JN871301
MH 07 *F: ACCTCGGATAGAAAACAGC
R: GTCGTATATAAAGTAAAGCATTGCC
(GA)4(CA)6(GA)1428457JN871302
MH 08 *F: TGAACTCCCCAGTCCCCACT
R: TCGGTCCACAATCATCACAAAA
(AG)2218762JN871303
MH 09 *F: TGGTCATCAACTATTTTCCCTC
R: ATGTATTCATTCAGGTATAGAGAGA
(TC)1415357JN871304
MH 10 *F: GTCCTCCATAGCCACAAA
R: TACTATAACTGATTTTCAAATTTCC
(GAA)1313059JN871305
MH 11 *F: GTCCTAGTGTACTTACCCATCA
R: GACAGCAATGCTCCGACT
(CA)1419261JN871306
MH 12F: CAATTCTTGAGCCACTTT
R: GCTTCTGCCAATGTTTAG
(GA)1320856JN871307
MH 13F: AAGAAGGTGAAGGAGGCT
R: AGATGGTCCCAATGTAGC
(TC)12(GT)7(CT)426249JN871308
MH 14F: GGGTTCAAGGCTCAGGAC
R: CATCCCATTGCCAACATC
(GA)1522149JN871309
MH 15F: TATGCTTGGGCAGGAATG
R: AACGCTGTGCTATCACTGTCTT
(GA)2120154JN871310
MH 16F: TTTTAGTAGGGTTCACCG
R: CCCACTCCTGGATGTTTG
(CT)3219254JN871311
MH 17F: ATTCTGTATCTGGCTCAC
R: GTCTTTCAAGCATAAAGA
(CT)14(CA)1127955JN871312
MH 18F: ACGAGCAGAAACTGGAAA
R: GCATTGTCCAACCCTTTA
(GT)11(GA)915358JN871313
MH 19F: TCTACTTCGGTTCAGGGTT
R: GCTTCCGCTGTAATGGTT
(TC)25(AC)528361JN871314
MH 20F: ATGACTCCACATAGCAAACA
R: CTGGGCTGATCCTAAACA
(AG)2023363JN871315
MH 21F: GGGAAATGGTTCTTTATGGT
R: TCATCATGGGTTGGGTTAT
(CT)2114259JN871316
MH 22F: CATCAACTCACGATTGCA
R: CGTTATGTTTCTTTTCTCCC
(TA)6(GA)1623655JN871317
MH 23F: GCAGGTGAGAATGCAAAT
R: AAGCAGCATCACAGTTCC
(AG)27(TG)415759JN871318
MH 24F: GCTTGTTTTGATGGTTGT
R: TAGGCGAATGATGCTTAT
(CA)13(GA)2542455JN871319

*Displayed polymorphisms in Luculia yunnanensis; Ta, PCR annealing temperature.

Table Table 2. Results of 11 polymorphic microsatellite loci screening in two populations of Luculia yunnanensis.

Click here to display table

Table 2. Results of 11 polymorphic microsatellite loci screening in two populations of Luculia yunnanensis.
Population 1 (N = 12)Population 2 (N = 12)

LocusNAHOHENAHOHE
MH 0140.8330.68430.6660.489
MH 0220.3330.46330.2500.539
MH 0330.0000.65240.0000.681
MH 0430.2500.56130.2500.684
MH 0540.4160.65540.5830.771
MH 0630.1660.68140.5000.753
MH 0720.3330.46350.5830.768
MH 0830.1660.59440.5000.699
MH 0940.2500.58740.5830.655
MH 1020.2500.43120.6660.463
MH 1130.6660.64830.3330.594

N, population sample size; NA, number of alleles revealed; HO, observed heterozygosity; HE, expected heterozygosity.

Int. J. Mol. Sci. EISSN 1422-0067 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert