ijms International Journal of Molecular Sciences Int. J. Mol. Sci. 1422-0067 Molecular Diversity Preservation International (MDPI) 10.3390/ijms13011154 ijms-13-01154 Article Isolation and Characterization of New 24 Microsatellite DNA Markers for Golden Cuttlefish (Sepia esculenta) YuanYanjiao12 LiuShufang2* BaiCuicui23 LiuHongbo23 ZhuangZhimeng2 Ocean University of Shanghai, Shanghai 201306, China; E-Mail: jiaoyy1987@163.com Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China; E-Mails: baicuicui77@163.com (C.B.); liuhongbo23@163.com (H.L.); zhuangzm@ysfri.ac.cn (Z.Z.) Ocean University of Dalian, Dalian 116023, China Author to whom correspondence should be addressed; E-Mail: liusf@ysfri.ac.cn; Tel.:+86-532-85836344-1520; Fax: +86-532-85811514. 2012 20 1 2012 13 1 1154 1160 23 12 2011 12 1 2012 13 1 2012 © 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. 2012

This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).

Twenty-four microsatellite DNA markers were isolated and characterized for golden cuttlefish (Sepia esculenta) from a (GT)13—enriched genomic library. Loci were tested in 48 individuals from Jiaozhou bay of China. The numbers of alleles per locus ranged from two to 25 with an average of 10.3. The observed and expected heterozygosities ranged from 0.063 to 0.896 and from 0.137 to 0.953, with averages of 0.519 and 0.633, respectively. Six loci significantly deviated from Hardy-Weinberg equilibrium after Bonferroni’s correction and no significant linkage disequilibrium between loci pairs was detected. These microsatellite markers would be useful for analyzing the population genetic structure to make conservation and management decisions for S. esculenta.

 golden cuttlefish Sepia esculenta microsatellite population structure 1. Introduction

Golden cuttlefish (Sepia esculenta) is a cephalopod that lives in neritic and abyssal zones, and sometimes in sandy habitats. It is widely distributed, from the island of Honshu in Japan to Vietnam and the Philippines. The golden cuttlefish is an economically important target species in China, South Korea and Japan [1–3]. Unfortunately, since the 1980s, S. esculenta resources have been gradually declining possibly due to over-exploitation and ocean environmental change, especially deterioration of the spawning grounds [3]. With respect to the four traditional main spawning grounds of S. esculenta along the coast of China, only one remains [4].

Estimating population genetic structure may lead to a better understanding of the effects of over-exploitation and environmental change on S. esculenta stocks, and the result would provide valid reference for the management and conservation of fishery resources [5–8]. Among molecular markers, microsatellite markers have been shown to be an extremely valuable tool for the study of population structure because of their variability, abundance, neutrality, co-dominance and unambiguous scoring of alleles [9,10]. Until now, 31 microsatellite markers have been reported for S. esculenta [6,8]. However, only 25 of these conformed to the Hardy-Weinberg equilibrium (HWE). Therefore, additional highly informative microsatellite markers are needed for investigating the population genetic structure.

 2. Results and Discussion

The number of alleles per locus ranged from two to 25, with an average of 10.3. The observed and expected heterozygosities ranged from 0.0625 to 0.8958 and from 0.1366 to 0.9533, with an average of 0.519 and 0.633, respectively (Table 1). Six loci (J5/J8/J17/J61/J63/J74) deviated from HWE in the tested population after Bonferroni’s correction (adjusted P-value < 0.002), which might be caused by the heterozygotes deficit. There are three possible explanations for the heterozygotes deficit. Firstly, it might be due to allelic “dropouts”, which are artifacts in the PCR amplification process. Secondly, the deficit might be caused by the limited sample size or size homoplasy. Thirdly, it could result from the presence of null alleles [11,12]. Twenty four microsatellite loci were tested for the presence of null alleles and the results showed that they might be present in seven loci (J5/J8/J10/J17/J60/J63/J74), five of which deviated from HWE. According to Zheng’ report, a significant deviation from HWE was observed in one locus, and null allele existed in the same locus [6]. Wang also reported that, significant occurrences of null alleles were found for four of five loci that deviated from HWE [8]. No significant linkage disequilibrium (LD) was found between all pairs of these 24 loci after Bonferroni’s correction (P-value > 0.002).

 3. Experimental Section 3.1. DNA Extraction

Forty-eight individuals of S. esculenta were collected from Jiaozhou bay and preserved in alcohol until DNA extraction. DNA was extracted from muscle tissue using the phenol-chloroform procedure [13].

 3.2. Microsatellite-Enriched Library Construction

Genomic DNA was simultaneously digested with Mse I for three hours (New England Biolabs, USA), and the digested DNA (10 μL) was ligated to Mse I adaptors (100 pmol) (5′-TACTCAGGAACTCAT-3′/5′-GACGATGAGTCCTGAG-3′). Linker-ligated DNA was amplified in a 25 μL reaction mix using the adapter-specific primer (5′-GATGAGTCCTGAGTAA-3′). Polymerase chain reaction (PCR) conditions were as follows: 20 cycles at 94 °C for 30 s, 53 °C for 1 min, 72 °C for 1 min. The PCR products were purified using DNAmate (TaKaRa, Japan) and hybridized to a biotin labeled (GT13 probe. The mixture was denatured at 94 °C for 5 min, then at 53 °C for 15 min. The hybrids were captured with streptavidin-coated magnetic beads (Promega, USA). Unhybridized DNA was washed away, and the remaining DNA was eluted from the magnetic beads and amplified using the adaptor-specific primer and the above PCR program. Following purification, DNA fragments ranging from 500 base pair to 1000 bp were selected by separation on 1.5% agarose gels. The fragments were ligated to pMD18-T vectors (TaKaRa), and transformed into Escherichia coli DH5α competent cells to construct an enriched microsatellite library. After amplifying with (GT)10 and M13 primers,180 positive clones were obtained. The positive clones were sequenced on an ABI 3730 automated DNA sequencer (Applied Biosystems, USA).

 3.3. PCR Amplification and Genotyping

Eighty-five pairs of primers were designed using PRIMER PREMIER5 (Premier Biosoft International, USA) and tested for polymorphism with six S. esculenta. After preliminary screening, only 24 polymorphic microsatellite loci were tested on a sample of 48 individuals. PCR for all loci was performed separately in a 25 μL reaction volume containing 0.4 μM of each primer, 0.2 mM dNTPs, 2 mM MgCl2, 1× PCR buffer, 1 U Taq polymerase (Fermentas, Canada) and 50–100 ng DNA. Amplification was carried out with the following thermal profile: 94 °C for 5 min, followed by 35 cycles of 94 °C for 45 s, optimal annealing temperature (Table 1) for 45 s, and 72 °C for 45 s, and a final extension step at 72 °C for 10 min. PCR products were separated on 6% denaturing polyacrylamide gels and visualized by silver-staining.

 3.4. Genetic Data Analysis

Allele sizes were estimated according to the pBR322/Msp I marker. The variability at each locus was measured in terms of number of alleles, expected heterozygosity and observed heterozygosity, and Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium were tested using GENEPOP 4.0 [14]. Null allele frequencies were calculated using Micro-Checker 2.2.3 [15]. The significant value for all diversity tests of significance was corrected by the sequential Bonferroni’s procedure [16].

 4. Conclusions

In the present study, we isolated and characterized 24 polymorphic microsatellite loci for S. esculenta. These new high variable microsatellite markers will enrich S. esculenta microsatellite marker resources and be useful for various population genetic analyses of S. esculenta. In our results, there are some highly heterozygous microsatellite loci (i.e., J13/J14/J35/J77), which we will use for designing conservation strategies for the management of S. esculenta stocks.

 Acknowledgements

This work was supported by the National Natural Science Foundation of China (Grant No. 31172411 & 31061160187) and Special Fund for Agroscientific Research in the Public Interest (Grant No. 200903005 & 201005013)

 References NesisK.N.Cephalopods of the WorldT. F. H. PublicationsNeptune City, NJ, USA1987109110 OkutaniT.Cuttlefish and Squids of the World in ColorNational Cooperative Association of Squid ProcessorsTokyo, Japan199543 HaoZ.L.ZhangX.M.ZhangP.D.Biological characteristics and multiplication techniques of S. esculenta (in Chinese)Chin. J. Ecol200726601606 LiuL.L.WanR.DuanY.Y.WangX.J.Status and effect of enhancement release of marine fisheries resource in ShandongTrans. Oceanol. Limnol200849198 ZhengX.D.ZhaoJ.M.ShuX.WangR.C.WangS.D.ZhouW.W.Isozymes analysis of the golden cuttlefish Sepia esculenta (Cephalopoda: Sepiidea)J. Ocean Univ. China20043485210.1007/s11802-004-0007-x ZhengX.D.IkedaM.BarinovaA.TaniguchiN.Isolation and characterization of microsatellite DNA loci from the golden cuttlefish, Sepia esculenta Hoyle (Cephalopoda)Mol. Ecol. Notes200774042 ZhengX.D.IkedaM.KongL.F.LinX.Z.LiQ.TaniguchiN.Genetic diversity and population structure of the golden cuttlefish, Sepia esculenta (Cephalopoda: Sepiidea) indicated by microsatellite DNA variationsMar. Ecol20093044845410.1111/j.1439-0485.2009.00294.x WangH.LinL.LiuS.F.Isolation and characterization of polymorphic microsatellite loci in golden cuttlefish (Sepia esculenta)Mol. Ecol. Resour20111141842110.1111/j.1755-0998.2010.02970.x21429157 LiaoM.J.WangY.G.RongX.J.ZhangZ.LiB.Development of new microsatellite DNA markers from apostichopus japonicus and their cross-species application in parastichopus parvimensis and pathallus mollisInt. J. Mol. Sci2011125862587010.3390/ijms1209586222016632 WangH.J.LinH.D.ZhangL.Y.DingS.X.Development and characterization of 20 microsatellite markers for Chinese black sleeper, bostrychus sinensisInt. J. Mol. Sci2011129570957510.3390/ijms1212957022272149 LinL.ZhuL.LiuS.F.SuY.Q.ZhuangZ.M.Polymorphic microsatellite loci for the Japanese anchovy Engraulis japonicus (Engraulidae)Genet. Mol. Res20111076476810.4238/vol10-2gmr108521563070 ManamiK.LiQ.AkihiroK.Isolation and characterization of twenty microsatellite loci in Japanese Sea Cucumber (Stichopus japonicus)Mar. Biotechnol2005717918310.1007/s10126-004-0006-315906112 SambrookJ.RussellD.W.Molecular Cloning: A Laboratory Manual3rd edCold Spring Harbor Laboratory PressNew York, NY, USA2001467470 RaymondM.RoussetF.Genepop (version 1.2), population genetics software for exact test and ecumenicismJ. Hered199586248249 Van OosterhoutC.HutchinsonW.F.Micro-checker: Software for identifying and correcting genotyping errors in microsatellite dataMol. Ecol. Notes2004453553810.1111/j.1471-8286.2004.00684.x RiceW.R.Analyzing tables of statistical testsEvolution19894322322510.2307/2409177 Table

Characterization of 24 microsatellite loci in 48 S. esculenta individuals.

Loci Genbank accession No. Repeat motif Primer sequence(5′-3′) Size range (bp) Ta (°C) NA HO HE PHW
J1 JQ317936 (TG)7 F: GGTCCAAAGTATGTGAAGR: GTGAAAATGTTGGGTTAT 242–245 55 4 0.2917 0.3535 0.0263
J3 JQ317937 (TG)9 F: TCCTCAATCCAAGTCGCTATR: AACCCAGACACTGATGGTAATC 343–360 55 8 0.3958 0.7627 0.0086
J5 JQ317938 (AC)11(AC)8(AT)8 F: ACGTTTATAAGAGCAACACR: CAGAATAGATTACCCACAA 217–260 57 18 0.6087 0.9200 0.0000*
J6-1 JQ317939 (TA)5 F: GCATCAAAACATAAATACR: ACTCACTACGAGAAATCA 309–330 55 5 0.4894 0.5468 0.2773
J6-2 JQ317939 (GT)6 F: GAATAATTACTCAGAGGCACR: TCTATTTCCATTTTCGTG 320–350 57 4 0.5455 0.5541 0.0474
J8 JQ317940 (CA)27 F: ATTTCAGTTATGGTCCTTGR: ATTCTGTAGCCATCAAGC 300–380 57 13 0.7083 0.8789 0.0006*
J10 JQ317941 (AC)6..(AC)23(ATC)5 F: CAGCCTCACTACGAAGAAR: RGATACGCAACCGAGACAC 300–330 45 5 0.3404 0.5269 0.0161
J12 JQ317942 (TG)9 F: CGTTTGCGTAGGATGTCAR: GTCGGTCTTGGTACTTTCAC 250–260 55 4 0.6250 0.6656 0.1807
J13 JQ317943 (TC)9(TC)6(CT)7(GTAT)7(TATC)7 F: TAAGTTTCGTAGGGTATCACR: ATGTATTTCGGCTTTGGA 290–380 55 17 0.8085 0.8943 0.0152
J14 JQ317944 (CA)12 F: CAAGCAGGATTCAAGTTCR: TTTATCATCATTCCCAGG 250–290 55 21 0.8958 0.9349 0.0913
J17 JQ317945 (TG)25 F: ATTGGAAATCGGTGAGCTR: GATGGGAGTTGGGAAATG 217–260 55 20 0.7234 0.8950 0.0000*
J19 JQ317946 (TG)16 F: ACTAGCTTAGCTGGAGACGR: GAAATTGGCTTGGTGATT 217–250 50 9 0.5227 0.6084 0.0265
J25 JQ317947 (AC)9 F: CACATGGCCTAAAGATTGR: AAGGGTGGAGAATAGTTTG 195–205 55 6 0.6458 0.6401 0.6535
J35 JQ317948 (AC)21 F: GAGAAGCGACAAGCAATAR: GACTGTAACCTGGAAGCA 220–270 57 19 0.8511 0.9272 0.0026
J48 JQ317949 (GT)6 F: GCAAACCAATAGGTCATCR: TACTTGTACCGAAAAGCA 270–290 57 5 0.4894 0.6436 0.0137
J50 JQ317950 (TG)6..(GA)5 F: TGTTCCGTGTCGCCTTTGR: TGGGTCGTTGGACAACCTG 217–230 55 4 0.2558 0.3425 0.0063
J58 JQ317951 (GT)10 F: AGACCCAGTAGTAAGCAAAR: TCCACTAACTTGGAGCAT 264 55 3 0.5106 0.6111 0.0110
J60 JQ317952 (TG)5 F: AATTTCGATCATCTTCCATR: CATTCCAATAGACATTTTGTA 190 55 2 0.0625 0.1366 0.0116
J61 JQ317953 (AG)27 F: CACAATGTATACTACGCCTCTR: ATGCTTACCTCTTTATCCG 240–300 55 20 0.8750 0.9419 0.0000*
J63 JQ317954 (AC)5(AC)13 F: GAAAACGATACAAGGAGTR: GTGCAAGAAACAAAGACA 260–309 55 13 0.6042 0.8936 0.0000*
J74 JQ317955 (AC)26 F: GTTGGGAAATGCAAAGTCR: CAAGTTACAGCGGAGAAA 242–309 52 25 0.8085 0.9533 0.0000*
J77 JQ317956 (CT)5(CA)18 F: TTCCTCACAAACTATTCTR: TGATTTCTCCATCTGTTA 310–400 55 10 0.6809 0.8055 0.1457
J78 JQ317957 (AC)9 F: TGTGAACCCGAAACGAACR: ATGGCAAGGAGAATGTGG 310–360 50 5 0.4894 0.7376 0.0024
J83 JQ317958 (TG)7 F: TAAGCAAGACCAGAGTAGCCR: GTAAATTGTTGTGCAAATCC 250–280 50 7 0.7391 0.8321 0.1032

Ta, annealing temperature (°C); NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity;

indicated deviation from Hardy-Weinberg equilibrium (P < 0.05) after Bonferroni’s correction; PHW, Hardy-Weinberg probability test.