Int. J. Mol. Sci. 2012, 13(1), 1154-1160; doi:10.3390/ijms13011154

Article
Isolation and Characterization of New 24 Microsatellite DNA Markers for Golden Cuttlefish (Sepia esculenta)
Yanjiao Yuan 1,2, Shufang Liu 2,*, Cuicui Bai 2,3, Hongbo Liu 2,3 and Zhimeng Zhuang 2
1
Ocean University of Shanghai, Shanghai 201306, China; E-Mail: jiaoyy1987@163.com
2
Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China; E-Mails: baicuicui77@163.com (C.B.); liuhongbo23@163.com (H.L.); zhuangzm@ysfri.ac.cn (Z.Z.)
3
Ocean University of Dalian, Dalian 116023, China
*
Author to whom correspondence should be addressed; E-Mail: liusf@ysfri.ac.cn; Tel.:+86-532-85836344-1520; Fax: +86-532-85811514.
Received: 23 December 2011; in revised form: 12 January 2012 / Accepted: 13 January 2012 /
Published: 20 January 2012

Abstract

: Twenty-four microsatellite DNA markers were isolated and characterized for golden cuttlefish (Sepia esculenta) from a (GT)13—enriched genomic library. Loci were tested in 48 individuals from Jiaozhou bay of China. The numbers of alleles per locus ranged from two to 25 with an average of 10.3. The observed and expected heterozygosities ranged from 0.063 to 0.896 and from 0.137 to 0.953, with averages of 0.519 and 0.633, respectively. Six loci significantly deviated from Hardy-Weinberg equilibrium after Bonferroni’s correction and no significant linkage disequilibrium between loci pairs was detected. These microsatellite markers would be useful for analyzing the population genetic structure to make conservation and management decisions for S. esculenta.
Keywords:
golden cuttlefish; Sepia esculenta; microsatellite; population structure

1. Introduction

Golden cuttlefish (Sepia esculenta) is a cephalopod that lives in neritic and abyssal zones, and sometimes in sandy habitats. It is widely distributed, from the island of Honshu in Japan to Vietnam and the Philippines. The golden cuttlefish is an economically important target species in China, South Korea and Japan [13]. Unfortunately, since the 1980s, S. esculenta resources have been gradually declining possibly due to over-exploitation and ocean environmental change, especially deterioration of the spawning grounds [3]. With respect to the four traditional main spawning grounds of S. esculenta along the coast of China, only one remains [4].

Estimating population genetic structure may lead to a better understanding of the effects of over-exploitation and environmental change on S. esculenta stocks, and the result would provide valid reference for the management and conservation of fishery resources [58]. Among molecular markers, microsatellite markers have been shown to be an extremely valuable tool for the study of population structure because of their variability, abundance, neutrality, co-dominance and unambiguous scoring of alleles [9,10]. Until now, 31 microsatellite markers have been reported for S. esculenta [6,8]. However, only 25 of these conformed to the Hardy-Weinberg equilibrium (HWE). Therefore, additional highly informative microsatellite markers are needed for investigating the population genetic structure.

2. Results and Discussion

The number of alleles per locus ranged from two to 25, with an average of 10.3. The observed and expected heterozygosities ranged from 0.0625 to 0.8958 and from 0.1366 to 0.9533, with an average of 0.519 and 0.633, respectively (Table 1). Six loci (J5/J8/J17/J61/J63/J74) deviated from HWE in the tested population after Bonferroni’s correction (adjusted P-value < 0.002), which might be caused by the heterozygotes deficit. There are three possible explanations for the heterozygotes deficit. Firstly, it might be due to allelic “dropouts”, which are artifacts in the PCR amplification process. Secondly, the deficit might be caused by the limited sample size or size homoplasy. Thirdly, it could result from the presence of null alleles [11,12]. Twenty four microsatellite loci were tested for the presence of null alleles and the results showed that they might be present in seven loci (J5/J8/J10/J17/J60/J63/J74), five of which deviated from HWE. According to Zheng’ report, a significant deviation from HWE was observed in one locus, and null allele existed in the same locus [6]. Wang also reported that, significant occurrences of null alleles were found for four of five loci that deviated from HWE [8]. No significant linkage disequilibrium (LD) was found between all pairs of these 24 loci after Bonferroni’s correction (P-value > 0.002).

3. Experimental Section

3.1. DNA Extraction

Forty-eight individuals of S. esculenta were collected from Jiaozhou bay and preserved in alcohol until DNA extraction. DNA was extracted from muscle tissue using the phenol-chloroform procedure [13].

3.2. Microsatellite-Enriched Library Construction

Genomic DNA was simultaneously digested with Mse I for three hours (New England Biolabs, USA), and the digested DNA (10 μL) was ligated to Mse I adaptors (100 pmol) (5′-TACTCAGGAACTCAT-3′/5′-GACGATGAGTCCTGAG-3′). Linker-ligated DNA was amplified in a 25 μL reaction mix using the adapter-specific primer (5′-GATGAGTCCTGAGTAA-3′). Polymerase chain reaction (PCR) conditions were as follows: 20 cycles at 94 °C for 30 s, 53 °C for 1 min, 72 °C for 1 min. The PCR products were purified using DNAmate (TaKaRa, Japan) and hybridized to a biotin labeled (GT13 probe. The mixture was denatured at 94 °C for 5 min, then at 53 °C for 15 min. The hybrids were captured with streptavidin-coated magnetic beads (Promega, USA). Unhybridized DNA was washed away, and the remaining DNA was eluted from the magnetic beads and amplified using the adaptor-specific primer and the above PCR program. Following purification, DNA fragments ranging from 500 base pair to 1000 bp were selected by separation on 1.5% agarose gels. The fragments were ligated to pMD18-T vectors (TaKaRa), and transformed into Escherichia coli DH5α competent cells to construct an enriched microsatellite library. After amplifying with (GT)10 and M13 primers,180 positive clones were obtained. The positive clones were sequenced on an ABI 3730 automated DNA sequencer (Applied Biosystems, USA).

3.3. PCR Amplification and Genotyping

Eighty-five pairs of primers were designed using PRIMER PREMIER5 (Premier Biosoft International, USA) and tested for polymorphism with six S. esculenta. After preliminary screening, only 24 polymorphic microsatellite loci were tested on a sample of 48 individuals. PCR for all loci was performed separately in a 25 μL reaction volume containing 0.4 μM of each primer, 0.2 mM dNTPs, 2 mM MgCl2, 1× PCR buffer, 1 U Taq polymerase (Fermentas, Canada) and 50–100 ng DNA. Amplification was carried out with the following thermal profile: 94 °C for 5 min, followed by 35 cycles of 94 °C for 45 s, optimal annealing temperature (Table 1) for 45 s, and 72 °C for 45 s, and a final extension step at 72 °C for 10 min. PCR products were separated on 6% denaturing polyacrylamide gels and visualized by silver-staining.

3.4. Genetic Data Analysis

Allele sizes were estimated according to the pBR322/Msp I marker. The variability at each locus was measured in terms of number of alleles, expected heterozygosity and observed heterozygosity, and Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium were tested using GENEPOP 4.0 [14]. Null allele frequencies were calculated using Micro-Checker 2.2.3 [15]. The significant value for all diversity tests of significance was corrected by the sequential Bonferroni’s procedure [16].

4. Conclusions

In the present study, we isolated and characterized 24 polymorphic microsatellite loci for S. esculenta. These new high variable microsatellite markers will enrich S. esculenta microsatellite marker resources and be useful for various population genetic analyses of S. esculenta. In our results, there are some highly heterozygous microsatellite loci (i.e., J13/J14/J35/J77), which we will use for designing conservation strategies for the management of S. esculenta stocks.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (Grant No. 31172411 & 31061160187) and Special Fund for Agroscientific Research in the Public Interest (Grant No. 200903005 & 201005013)

References

  1. Nesis, K.N. Cephalopods of the World; T. F. H. Publications: Neptune City, NJ, USA, 1987; pp. 109–110.
  2. Okutani, T. Cuttlefish and Squids of the World in Color; National Cooperative Association of Squid Processors: Tokyo, Japan, 1995; p. 43.
  3. Hao, Z.L.; Zhang, X.M.; Zhang, P.D. Biological characteristics and multiplication techniques of S. esculenta (in Chinese). Chin. J. Ecol 2007, 26, 601–606.
  4. Liu, L.L.; Wan, R.; Duan, Y.Y.; Wang, X.J. Status and effect of enhancement release of marine fisheries resource in Shandong. Trans. Oceanol. Limnol 2008, 4, 91–98.
  5. Zheng, X.D.; Zhao, J.M.; Shu, X.; Wang, R.C.; Wang, S.D.; Zhou, W.W. Isozymes analysis of the golden cuttlefish Sepia esculenta (Cephalopoda: Sepiidea). J. Ocean Univ. China 2004, 3, 48–52.
  6. Zheng, X.D.; Ikeda, M.; Barinova, A.; Taniguchi, N. Isolation and characterization of microsatellite DNA loci from the golden cuttlefish, Sepia esculenta Hoyle (Cephalopoda). Mol. Ecol. Notes 2007, 7, 40–42.
  7. Zheng, X.D.; Ikeda, M.; Kong, L.F.; Lin, X.Z.; Li, Q.; Taniguchi, N. Genetic diversity and population structure of the golden cuttlefish, Sepia esculenta (Cephalopoda: Sepiidea) indicated by microsatellite DNA variations. Mar. Ecol 2009, 30, 448–454.
  8. Wang, H.; Lin, L.; Liu, S.F. Isolation and characterization of polymorphic microsatellite loci in golden cuttlefish (Sepia esculenta). Mol. Ecol. Resour 2011, 11, 418–421.
  9. Liao, M.J.; Wang, Y.G.; Rong, X.J.; Zhang, Z.; Li, B. Development of new microsatellite DNA markers from apostichopus japonicus and their cross-species application in parastichopus parvimensis and pathallus mollis. Int. J. Mol. Sci 2011, 12, 5862–5870.
  10. Wang, H.J.; Lin, H.D.; Zhang, L.Y.; Ding, S.X. Development and characterization of 20 microsatellite markers for Chinese black sleeper, bostrychus sinensis. Int. J. Mol. Sci 2011, 12, 9570–9575.
  11. Lin, L.; Zhu, L.; Liu, S.F.; Su, Y.Q.; Zhuang, Z.M. Polymorphic microsatellite loci for the Japanese anchovy Engraulis japonicus (Engraulidae). Genet. Mol. Res 2011, 10, 764–768.
  12. Manami, K.; Li, Q.; Akihiro, K. Isolation and characterization of twenty microsatellite loci in Japanese Sea Cucumber (Stichopus japonicus). Mar. Biotechnol 2005, 7, 179–183.
  13. Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001; pp. 467–470.
  14. Raymond, M.; Rousset, F. Genepop (version 1.2), population genetics software for exact test and ecumenicism. J. Hered 1995, 86, 248–249.
  15. Van Oosterhout, C.; Hutchinson, W.F. Micro-checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538.
  16. Rice, W.R. Analyzing tables of statistical tests. Evolution 1989, 43, 223–225.
Table 1. Characterization of 24 microsatellite loci in 48 S. esculenta individuals.

Click here to display table

Table 1. Characterization of 24 microsatellite loci in 48 S. esculenta individuals.
LociGenbank accession No.Repeat motifPrimer sequence(5′-3′)Size range (bp)Ta (°C)NAHOHEPHW
J1JQ317936(TG)7F: GGTCCAAAGTATGTGAAG
R: GTGAAAATGTTGGGTTAT
242–2455540.29170.35350.0263
J3JQ317937(TG)9F: TCCTCAATCCAAGTCGCTAT
R: AACCCAGACACTGATGGTAATC
343–3605580.39580.76270.0086
J5JQ317938(AC)11(AC)8(AT)8F: ACGTTTATAAGAGCAACAC
R: CAGAATAGATTACCCACAA
217–26057180.60870.92000.0000*
J6-1JQ317939(TA)5F: GCATCAAAACATAAATAC
R: ACTCACTACGAGAAATCA
309–3305550.48940.54680.2773
J6-2JQ317939(GT)6F: GAATAATTACTCAGAGGCAC
R: TCTATTTCCATTTTCGTG
320–3505740.54550.55410.0474
J8JQ317940(CA)27F: ATTTCAGTTATGGTCCTTG
R: ATTCTGTAGCCATCAAGC
300–38057130.70830.87890.0006*
J10JQ317941(AC)6..(AC)23(ATC)5F: CAGCCTCACTACGAAGAA
R: RGATACGCAACCGAGACAC
300–3304550.34040.52690.0161
J12JQ317942(TG)9F: CGTTTGCGTAGGATGTCA
R: GTCGGTCTTGGTACTTTCAC
250–2605540.62500.66560.1807
J13JQ317943(TC)9(TC)6(CT)7(GTAT)7(TATC)7F: TAAGTTTCGTAGGGTATCAC
R: ATGTATTTCGGCTTTGGA
290–38055170.80850.89430.0152
J14JQ317944(CA)12F: CAAGCAGGATTCAAGTTC
R: TTTATCATCATTCCCAGG
250–29055210.89580.93490.0913
J17JQ317945(TG)25F: ATTGGAAATCGGTGAGCT
R: GATGGGAGTTGGGAAATG
217–26055200.72340.89500.0000*
J19JQ317946(TG)16F: ACTAGCTTAGCTGGAGACG
R: GAAATTGGCTTGGTGATT
217–2505090.52270.60840.0265
J25JQ317947(AC)9F: CACATGGCCTAAAGATTG
R: AAGGGTGGAGAATAGTTTG
195–2055560.64580.64010.6535
J35JQ317948(AC)21F: GAGAAGCGACAAGCAATA
R: GACTGTAACCTGGAAGCA
220–27057190.85110.92720.0026
J48JQ317949(GT)6F: GCAAACCAATAGGTCATC
R: TACTTGTACCGAAAAGCA
270–2905750.48940.64360.0137
J50JQ317950(TG)6..(GA)5F: TGTTCCGTGTCGCCTTTG
R: TGGGTCGTTGGACAACCTG
217–2305540.25580.34250.0063
J58JQ317951(GT)10F: AGACCCAGTAGTAAGCAAA
R: TCCACTAACTTGGAGCAT
2645530.51060.61110.0110
J60JQ317952(TG)5F: AATTTCGATCATCTTCCAT
R: CATTCCAATAGACATTTTGTA
1905520.06250.13660.0116
J61JQ317953(AG)27F: CACAATGTATACTACGCCTCT
R: ATGCTTACCTCTTTATCCG
240–30055200.87500.94190.0000*
J63JQ317954(AC)5(AC)13F: GAAAACGATACAAGGAGT
R: GTGCAAGAAACAAAGACA
260–30955130.60420.89360.0000*
J74JQ317955(AC)26F: GTTGGGAAATGCAAAGTC
R: CAAGTTACAGCGGAGAAA
242–30952250.80850.95330.0000*
J77JQ317956(CT)5(CA)18F: TTCCTCACAAACTATTCT
R: TGATTTCTCCATCTGTTA
310–40055100.68090.80550.1457
J78JQ317957(AC)9F: TGTGAACCCGAAACGAAC
R: ATGGCAAGGAGAATGTGG
310–3605050.48940.73760.0024
J83JQ317958(TG)7F: TAAGCAAGACCAGAGTAGCC
R: GTAAATTGTTGTGCAAATCC
250–2805070.73910.83210.1032

Ta, annealing temperature (°C); NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity;*indicated deviation from Hardy-Weinberg equilibrium (P < 0.05) after Bonferroni’s correction; PHW, Hardy-Weinberg probability test.

Int. J. Mol. Sci. EISSN 1422-0067 Published by MDPI AG, Basel, Switzerland RSS E-Mail Table of Contents Alert